Desvendando o CSI

Pra quem já viu CSI Miami alguma vez na vida deve estar se perguntando o que essa foto está fazendo na capa de um post de bioinfo, e a resposta é bem simples: eu adoro séries policiais! Mas, brincadeiras a parte, as séries policiais costumam ter tudo a ver com minha área de atuação, a biotecnologia, e em alguns episódios podemos até encontrar aplicação para a bioinformática. Sendo assim, o que você acha de desvendar alguns mistérios desse mundo?

Para começar a contextualizar… um belo dia, eu estava assistindo a um dos episódios da série intitulado “Time bomb” (S8E23), e durante o desenrolar da história alguns diamantes foram encontrados na casa de um dos agentes, o personagem Ryan, que foi associado a um assassinato e a uma explosão graças a isso. Como já era de se esperar, o desfecho não poderia ser tão simples, e por isso não foram encontradas digitais nos diamantes que pudessem vir a incriminar outra pessoa. Os policiais tiveram, então, que buscar novas alternativas para encontrar pistas que realmente incriminassem Ryan, ou que viessem a inocentá-lo.

Nesse ponto do episódio surgiu uma ideia brilhante, principalmente por me fazer associar a técnica utilizada à bioinformática e me ajudar a escrever esse post!  A ideia era desenvolver uma nova metodologia de digitais, utilizando “marcas” que não fossem facilmente eliminadas dos diamantes, e por que não utilizar os microrganismos presentes na pele? Aqui você deve estar começando a ficar assustado, porque temos a mania de relacionarmos eles a doenças, e nem sempre é assim. Cada um de nós temos uma microbiota residente, ou seja, microrganismos que colonizam alguma parte do nosso corpo sem causar danos em condições normais e, em alguns casos, até auxiliando o bom funcionamento do nosso organismo; e foi justamente a microbiota das mãos que eles utilizaram como uma digital.

Agora, o que isso tem a ver com a bioinformática? Ao assistir esse episódio, e mais especificamente o trecho em questão, me veio à mente a utilização de sequenciamento de DNA para identificar sequencias especificas desses microrganismos, e a partir disso comparar as mesmas sequencias com possíveis suspeitos. Uma possibilidade seria sequenciar regiões 16S de bactérias, que são sequencias bem conservadas dentro de espécies, mas apresentando diferenças significativas entre espécies. Esses sequenciamentos gerariam um grupo de sequencias que deveriam ser exatamente igual as do suspeito.

Essas comparações entre as sequências obtidas são conhecidas na bioinformática como alinhamento, e eles podem ser de dois tipos basicamente, global e local (Figura 1). O primeiro, trabalha com a sequência como um todo, exigindo que 100% das bases dessa sequência sejam alinhadas, ainda que existam diferenças entre elas. Enquanto o segundo, trabalha com uma pequena parte da sequência, permitindo que sejam eliminadas regiões incompatíveis. Vocês já devem imaginar qual tipo de alinhamento seria utilizado para testar as sequências obtidas da mão do Ryan com as obtidas pelo diamante, não? Quem pensou em alinhamento global já deu o primeiro passo rumo ao incrível mundo da bioinfo.

Referência:           ATTGCGACTACGCGGTACAGACTTACGGCT

Sequência 1:           ATTGCCACTACGCAGTACAGACTACGGCT

Sequência 2:           GACATCGCTACGCGGTACAGACTTCTATGC

Alinhamento Global:

                                         Referência:           ATTGCGACTACGCGGTACAGACTTACGGCT

                                         Sequência 1:         ATTGCCACTACGCAGTACAGACT    ACGGCT

Alinhamento Local:

                                         Referência:           ATTGCGACTACGCGGTACAGACTTACGGCT

                                         Sequência 2:                            CTACGCGGTACAGACTT

Figura1. Imaginem uma sequência de fotos utilizada como referência, e duas outras sequências que deveriam ser alinhadas a ela. No alinhamento Global, toda a sequência deve ser comparada (esquerda), enquanto o alinhamento local considera apenas a região semelhante ao alinhamento (direita).

Só finalizando a história, o teste deu negativo para o Ryan, mas positivo para um segundo suspeito, que vocês podem descobrir quem era assistindo o episódio… Boa diversão e até o próximo post.

Referências:

https://www.csifiles.com/content/2010/05/review-csi-miami-time-bomb/

https://www.researchgate.net/profile/Wagner_Arbex/publication/221875655_Bioinformatica_como_ferramenta_nas_pesquisas_atuais/links/02bfe513f4e8c3c00f000000/Bioinformatica-como-ferramenta-nas-pesquisas-atuais.pdf

http://www2.fm.usp.br/iof/mostrahp.php?origem=iof&xcod=Tecnologia%20em%20Ci%EAncias%20Forenses

http://www.ufjf.br/microbiologia/files/2012/12/Microrganismos-e-hospedeiros.pdf

Tags , , , , , .Adicionar aos favoritos o Link permanente.

Sobre Sheila Tiemi Nagamatsu

Formada em Biotecnologia pela UFSCar, Dra. em Genética e Biologia Molecular com ênfase em Bioinformática na UNICAMP, apaixonada por desenvolvimento pessoal e, atualmente, pós-doutoranda em YALE na área de psiquiatria.

Deixe um comentário

O seu endereço de e-mail não será publicado.