Carnaval Macabro

Bem vindo à "festa da carne"!

ResearchBlogging.orgPreparado para curtir o carnaval? Beber bastante, soltar as frangas, viver como se o mundo fosse acabar? Parabéns! Isso significa que você está vivendo o pré-apocalipse do jeito certo! Mas se você não gostar muito de carnaval e das coisas que todo mundo faz nessa época: dane-se! Você sabe que o mundo não passa desse ano mesmo!

Guerra, Fome, Peste… Escolha o seu cavaleiro do apocalipse. Se √© para ser antinatural e apelativo, escolho ent√£o algo entre a Peste e a Morte. Escolho Zumbis! Vamos divagar como essas criaturas hipot√©ticas podem existir, e se existirem, se n√≥s realmente estar√≠amos perdidos. Al√©m de como a Biologia Sint√©tica pode dar um empurr√£ozinho nisso tudo, √© claro.

Jumbie, Nzambi, Zonbi… Zumbi!

Feiticeiro Haitiano, "bokor"

Apesar das refer√™ncias folcl√≥ricas europeias envolvendo indiv√≠duos que insistem em n√£o admitir que est√£o mortos (como esp√≠ritos amaldi√ßoados e vampiros), as grandes influ√™ncias na no√ß√£o popular do Zumbi de hoje s√£o mais africanas (e de outras culturas derivadas do continente m√£e). Em especial no Haiti, onde o Vodu (Voodoo) √© ainda culturalmente marcante. At√© existem “feiticeiros” que trazem os “mortos √† vida”.

Existem v√°rios tipos de Zumbi, que podem ser classificados √† partir da maneira como eles se tornam “mortos-vivos”. Acho que √© poss√≠vel separar o joio do trigo em duas classifica√ß√Ķes iniciais: “puni√ß√£o divina”, e “coquetel de subst√Ęncias” (drogas) ou “doen√ßa bizarra”. Como vamos falar de algo mais cient√≠fico prefiro n√£o comentar como um deus raivoso¬†(ou simplesmente sacana) pode criar coisas meio-mortas .

Dorgas Zumbi

"Cadê as minhas Dorgas!?"

Os Zumbis existem de verdade, sem brincadeira. Pelo menos aqueles criados com um coquetel de subst√Ęncias. H√° anos no Haiti existe o “processo de zumbifica√ß√£o”, em que “feiticeiros” (chamados de bokor) preparam um poderoso (e controverso) coquetel de subst√Ęncias que, segundo os praticantes do ritual, podem trazer pessoas aparentemente mortas √† vida, mas sem vontade pr√≥pria, sem personalidade. No caso, o indiv√≠duo n√£o √© realmente um “morto”-vivo: fica mais para um “dopad√£o”-vivo.

Essa hist√≥ria √© fascinante demais para algum cientista – e portanto nerd – n√£o se importar. Por isso, l√° nos idos dos anos 80, um canadense chamado Wade Davis viajou at√© o Caribe para escrever – talvez um dos primeiros estudos sobre Zumbis – o que se tornou um marco da “etnofarmacologia” (estudos de potenciais agentes farmacol√≥gicos atrav√©s de refer√™ncias etnogr√°ficas – resumindo: √© quando um cientista “vai l√°” ver se realmente faz sentido as mandigas xam√Ęnicas que a sua v√≥ usa para curar seus “resfriados”): o best seller “The Serpent and the Rainbow”¬†(“A Serpente e o Arco-√≠ris” – tem um filme de terror mesmo nome baseado no livro).¬†Nele, al√©m das narrativas de viagem pelo Haiti, Davis documentou atrav√©s de dois “informantes” duas receitas do “veneno Zumbi”, al√©m de narrar seus efeitos nos “rituais” que presenciou. Como eu n√£o quero ningu√©m criando Zumbis por a√≠ e botando a culpa em mim, s√≥ vou mostrar os ingredientes que o Dr. Davis encontrou (como consegui-los e preparar o neg√≥cio √© segredo!). D√™ uma olhada aqui.

Dessa lista, os ingredientes mais interessantes s√£o os peixes. Deles √© poss√≠vel obter duas neurotoxinas poderosas, componentes chave da zumbifica√ß√£o, induzindo catalepsia¬†ou paralisia motora: a saxitoxina e a tetroxina (TTX). Outros sintomas dessas subst√Ęncias incluem:

  • Entorpecimento (“paralisia”) da face e de outras √°reas
  • Paralisia motora das extremidades
  • Descoordena√ß√£o
  • Fala “arrastada”
  • Pupilas dilatadas

Tudo isso com o indivíduo ainda consciente e com seus reflexos inalterados. Até nos piores filmes trash sobre zumbis essas características estão presentes na pantomima do ator.

Davis afirmou em sua tese de PhD que o uso do coquetel de neurotoxinas do “Zombie Poison” pode causar danos no sistema nervoso, em especial devido √† TTX. Alucin√≥genos , bem como os danos das neurotoxinas poderiam adicionar aquele conhecido comportamento demente dos zumbis aos sintomas ditos anteriormente.

O Esc√Ęndalo Cient√≠fico

OK, vocês acharam que os cientistas iriam acreditar nessa história de Zumbis sem ser detalhadamente bem contada!? Sim: o senhor Davis causou um reboliço. Por cinco motivos principais:

“Indiana Jones”

Foi assim que muitos antrop√≥logos criticaram o texto do primeiro livro de Davis, que mistura relat√≥rio cient√≠fico, narrativa de viagem e hist√≥ria de aventura. Uma senhora pseudoci√™ncia. Claramente atingido pelas cr√≠ticas, Davis escreveu outro livro (“Passage of Darkness”). Mais acad√™mico, agradando grande parte dos cr√≠ticos:¬† “[O livro] Tece as conclus√Ķes de v√°rios diferentes campos acad√™micos em um argumento provocativo…”, segundo um review da obra, que apesar dos pesares, tamb√©m foi chamada de “sensacionalista”.

Caricatura

Muitos antropólogos acusaram Davis de caricaturar o Vodu como um sistema cultural fechado desde o século 18, desconectado de todas as formas de mudança social de política do Haiti.

TTX

O grande trunfo da ideia era tentar relacionar o comportamento zumbi com um efeito de uma neurotoxina, s√≥ que isso n√£o deu muito certo. Um estudo feito por dois eminentes toxicologistas japoneses testou oito amostras do veneno zumbi que Davis coletou e encontrou a presen√ßa de TTX em apenas uma das amostras, e mesmo assim, o meio alcalino em que essa subst√Ęncia se encontrava a deixava farmacologicamente inativa. Isso sem falar que Davis foi acusado de forjar os resultados da presen√ßa de TTX em sua tese de PhD, apresentando os resultados antes de serem confirmados.

Quest√£o Cultural

Alguns cr√≠ticos disseram que o coquetel de subst√Ęncias era um grande efeito placebo associado a alucin√≥genos: s√≥ funcionava porque as pessoas realmente temiam ser transformadas em zumbi e realmente acreditavam na exist√™ncia de mortos-vivos. Davis dizia que o efeito cultural tinha enorme influ√™ncia no funcionamento do “zombie poison”, para ser realmente algo “zumbificante”. Cr√≠ticos rebateram o argumento dizendo que n√£o fazia nenhum sentido uma subst√Ęncia como a TTX – que em certas concentra√ß√Ķes pode matar – “n√£o fazer efeito” por uma quest√£o cultural.

Prova

Algo que irritou profundamente os críticos foi a posição de Davis em rebater as críticas à falta de provas envolvendo a TDT. Segundo ele, assim como ele não provou nada, os críticos não provaram o contrário para refutar suas teorias. Péssimo argumento.

Assim fica difícil confirmar os efeitos relatados por Davis em sua pesquisa. Alguns dizem que grande parte da resistência acadêmica ao seu trabalho provinha da quebra de protocolos científicos referente ao estilo de relato científico de Davis, outros ainda afirmam que se a mesma pesquisa tivesse sido realizada dez anos depois, a comunidade científica da etnofarmacologia (campo interdisciplinar que une áreas quase incompatíveis, nova na época) seria mais flexível e se comportaria diferente em relação à pesquisa e como foi feita. Mesmo assim, é um jeito possível Рfalta provar! Рde criar zumbis de verdade, mesmo que temporariamente (isso se houver sobrevivência!). Só que isso ainda está longe de criar um apocalipse.

Doenças Bizarras Hipotéticas

"Warning: Zombies!"

Um apocalipse zumbi s√≥ pode acontecer com uma doen√ßa fulminantemente transmiss√≠vel e que d√™ caracter√≠sticas de um zumbi ao infectado. De todos os filmes, s√©ries, livros e jogos sobre zumbis, a teoria mais interessante que explica sua exist√™ncia √© aquela envolvendo o v√≠rus da raiva: essa doen√ßa √© perfeita como vetor zumbificante! Partindo do pressuposto que um zumbi √© um ser humano doente, agressivo ¬†e psic√≥tico¬†o suficiente (perdendo at√© mesmo sua “personalidade”) para continuar seu comportamento agressivo mesmo quando severamente sequelado; a raiva se encaixaria muito bem em muitas dessas caracter√≠sticas. Isso sem falar no quesito biol√≥gico: ela age no sistema nervoso e se transmite pela saliva! Logo, mordida = infec√ß√£o, igual a todo bom zumbi que se v√™ por a√≠ na cultura pop.

O que falta então para termos uma epidemia de raiva que gere zumbis!? Três coisas: letalidade, efeitos no sistema nervoso e principalmente: a transmissibilidade do vírus.

Sendo menos letal, ou seja, demorando mais para matar o indiv√≠duo (ou quem sabe, nem chegando a o matar), poder√≠amos ter zumbis que vivessem o suficiente para causarem estrago por a√≠. Tamb√©m, se o efeito causado no sistema nervoso central se espalhasse para regi√Ķes espec√≠ficas do c√©rebro, seria poss√≠vel causar os comportamentos dementes e animalescos dos zumbis. Mas o grande fator pand√™mico de tudo seria a transmiss√£o da doen√ßa. Ultimamente, tornar super transmiss√≠vel uma doen√ßa em laborat√≥rio √© o grande “tiro pela culatra” do momento nos esfor√ßos em tentar fazer o oposto: combater doen√ßas. Isso √© um grande problema de…

Biossegurança

Gripe Avi√°ria provocada pelo H5N1

Um recente trabalho submetido para publica√ß√£o na Science causou grande alarde mostrando como fazer o v√≠rus da gripe avi√°ria (H5N1) se tornar extremamente contagioso com apenas cinco muta√ß√Ķes “f√°ceis” no c√≥digo gen√©tico do v√≠rus. A pesquisa foi prontamente passada para a supervis√£o da americana NSABB (National Science Advisory Board for Biosecurity), e ainda h√° o debate entre os benef√≠cios e malef√≠cios da publica√ß√£o de tal conte√ļdo, que poderia ser utilizado para construir uma arma biol√≥gica.

Com um √≠ndice de letalidade quase chegando aos 60% – controv√©rsias √† parte, segundo outros dados, esse n√ļmero poderia ser bem menor¬†devido √† um grande n√ļmero de pessoas infectadas mas que n√£o mostraram sintomas¬†-, uma epidemia de H5N1 seria devastadora. Imagine ent√£o se fosse poss√≠vel fazer o mesmo com o nosso v√≠rus hipot√©tico da raiva: estar√≠amos perdidos. Se duvida, veja o resultado de alguns modelos matem√°ticos simplificados envolvendo um apocalipse zumbi no Meio de Cultura.

Some a tudo isso a grande facilidade que a Biologia Sint√©tica traz √† engenharia gen√©tica. Com a padroniza√ß√£o de partes biol√≥gicas, m√©todos r√°pidos de s√≠ntese de DNA e o crescente desenvolvimento de t√©cnicas de biologia molecular, √© extremamente mais f√°cil para um bioterrorista iniciar desde um¬† hipot√©tico apocalipse zumbi at√© a uma super gripe avi√°ria em sua pr√≥pria “garagem”! O que devemos dar import√Ęncia na verdade √© na regulariza√ß√£o dessas atividades, que apesar de revolucion√°rias, tamb√©m podem ser usadas para o mal como todo grande avan√ßo da ci√™ncia. Segundo uma recente publica√ß√£o em um dos blogs da Nature, at√© mesmo nos EUA as pol√≠ticas envolvendo biologia sint√©tica est√£o devagar demais para serem implementadas. Imagine no Brasil, que nem conhece direito Synbio, e que ainda luta para conter epidemias menos letais, como a dengue.

Se 2012 √© realmente o √ļltimo dos anos como os Maias dizem, √© melhor n√£o acelerar o processo nesse carnaval. √Č a √©poca perfeita n√£o s√≥ para iniciar um apocalipse zumbi, mas tamb√©m ideal para qualquer doen√ßa “menos pior” (ou nem tanto). Tamb√©m, dado o conjunto de particularidades que devem acontecer simultaneamente para existir uma doen√ßa zumbificante, √© melhor se preocupar em n√£o se tornar um morto-vivo, mas em um “morto-morto” mesmo! Ou pelo menos em n√£o ficar t√£o est√ļpido quanto um zumbi.

 

Referências

Papers

Albuquerque, UP. et al. (2011). Natural Products from Ethnodirected Studies: Revising the Ethnobiology of the Zombie Poison Evidence-Based Complementary and Alternative Medicine, 2012 : 10.1155/2012/202508

Inglis D (2010).The Zombie from Myth to Reality: Wade Davis, Academic Scandal and the Limits of the Real scripted, 7 (2) : 10.2966/scrip.070210.351

Sites

Nature News Blog: “Report finds US slow to implement synthetic biology policies

NewScientist: “Five easy mutations to make bird flu a lethal pandemic

Info: “Cientista cria v√≠rus H5N1 mutante, super contagioso

 

Blogagem coletiva Fim do Mundo

Esse foi um post da blogagem coletiva “2012: o √ļltimo carnaval?” promovida pelo ScienceBlogs Brasil, com a colabora√ß√£o especial do desenhista Pedro Pantai, que elaborou a primeira imagem desse post. Clique nela para acessar o blog de tirinhas do artista.

DNA como Código de Barras

DNA barcodeDesde o incr√≠vel advento do¬†sequenciamento¬†g√™nico l√° pelos idos dos anos 70 o volume de dados obtidos das mais variadas combina√ß√Ķes de nucleot√≠deos encontradas na natureza √© estonteante. Fazendo um c√°lculo bem simples com s√≥ cinco nucleot√≠deos, temos 3125 combina√ß√Ķes diferentes das letrinhas A,T,C e G!

√Č l√≥gico que hoje tamb√©m conhecemos uma enorme quantidade de padr√Ķes dessas letrinhas que nos dizem: “Olha, aqui termina um gene!”, ou “√Č aqui que o ribossomo gruda!”, entre outras coisas. O ruim √© que s√≥ √† partir do DNA √© bem mais trabalhoso e dif√≠cil dizer de qual criatura vieram aquelas informa√ß√Ķes encriptadas ali quando comparada √† mera observa√ß√£o daquele ser vivo. E em alguns casos, mesmo que se conhe√ßa de onde vem o DNA, h√° a d√ļvida se ele veio mesmo de onde parece ter vindo: como se poderia ter certeza, por exemplo, se aquela bonita carteira de couro que te deram de presente n√£o veio de uma esp√©cie de jacar√© em extin√ß√£o em vez de um r√©ptil criado em cativeiro!? A grande ideia √© fazer o mesmo que voc√™ faz quando vai ao supermercado: em vez de escanear cada dobra da embalagem, abri-la, fazer uma fina an√°lise do conte√ļdo, al√©m de ter que sair por a√≠ perguntado quanto custa, basta colocar aquela figurinha cheia de barras que existe em algum canto da embalagem num detector e pronto! Voc√™ passa a saber com rapidez do que se trata aquilo. No c√≥digo gen√©tico tenta se fazer a mesma coisa.

A Vida Rotulada

A regi√£o do DNA (l√≥cus) que deve ser usada para ser um “c√≥digo de barras” (CB) tem que ao mesmo tempo ser conservada e vari√°vel, do mesmo modo que os CB’s s√£o todos barrinhas pretas de mesmo tamanho, mas com comprimentos e espa√ßamentos vari√°veis. Essa regi√£o pode variar com os reinos dos seres vivos, mas no caso dos eucariotos, a regi√£o de 648 pares de bases do DNA mitocondrial que codifica a subunidade 1 da enzima citocromo mitocondrial C oxidase, √© hoje amplamente usada como c√≥digo de barras. O DNA mitocondrial √© ideal para ser usado como CB uma vez que sua taxa de muta√ß√£o nos seres vivos durante a evolu√ß√£o √© muito alta, o que resulta em uma varia√ß√£o significativa das sequ√™ncias entre as esp√©cies.

Rotulando uma parte pelo todo √© muito mais f√°cil para os bi√≥logos associarem uma marca √ļnica de cada esp√©cie √†s suas j√° elaboradas classifica√ß√Ķes do zool√≥gico da vida, al√©m de tornar muito mais f√°cil o controle, detec√ß√£o e prote√ß√£o de v√°rias esp√©cies de animais. Exitem grandes bancos de dados com um n√ļmero crescente de DNA Barcodes (c√≥digos de barras de DNA), um dos mais not√≥rios √© o projeto International Barcode of Life¬†(Com site muito bonito ali√°s!) que j√° conta – pelo menos at√© agora pouco quando dei uma olhada – cerca de 1 milh√£o e 330 mil esp√©cies no cat√°logo.

Código de Barras Literal

Aqui √© o ponto em que a biologia sint√©tica, ou pelo menos a engenharia gen√©tica, entra nisso tudo: como rotular os transg√™nicos? Bem, esse √© um probleminha que foi bem discutido nos √ļltimos anos que se passaram, principalmente porque as ind√ļstrias n√£o queriam facilitar que sua tecnologia fosse copiada por outras companhias, enquanto governos e opini√£o p√ļblica queriam uma regulamenta√ß√£o que gerassem medidas que discriminassem um produto transg√™nico de um n√£o-transg√™nico – um pouco por motivos ideol√≥gico-sociais, mas principalmente por motivos ecol√≥gicos: tornando a possibilidade de rastrear os culpados na hip√≥tese de uma contamina√ß√£o em certeza, haveria uma maior press√£o para execu√ß√£o adequada das medidas de seguran√ßa impostas pela lei.

Foi aí então que criaram Рou melhor patentearam Рuma padronização para códigos de barras bem interessante, que além de naturalmente tornar a identificação do transgênico muito mais fácil à partir de uma simples amostra de DNA, mantém a tecnologia em segredo e ainda conta com os mesmos processos utilizados em computador para correção de dados e compactação dos mesmos. Além dessa padronização que iremos explicar adiante, o próprio pessoal do Registro de Partes Padrão desenvolveu um Barcode para os Biobricks, que não é tão sofisticado, mas que corresponde à sua finalidade.

Escrevendo Com Quatro Letras

Para escrever textos com apenas quatro letras é muito simples se você sabe escrever

Imagem modificada retirada de http://tinyurl.com/3g46mnj

letras com n√ļmeros. Os computadores usam uma tabela que traduz o valores num√©ricos (ou melhor, bits) associados √† um caractere do alfabeto alfanum√©rico: a famosa tabela ASCII. Para escrever letras no DNA ent√£o √© muito mais f√°cil que no computador, principalmente porque ele utiliza o sistema bin√°rio de contagem, enquanto no DNA √© poss√≠vel usar o quatern√°rio, com os 4 “n√ļmeros” poss√≠veis: A, T, C e G, valendo 0, 1, 2, e 3 respectivamente (ver figura ao lado).

Com isso foi poss√≠vel criar a seguinte (ver imagem abaixo) constru√ß√£o n√£o-codificante de DNA que conta com informa√ß√Ķes relativas √† por exemplo o nome da companhia, a esp√©cie que foi modificada, ao ano em que o transg√™nico foi constru√≠do, e qual constru√ß√£o √© aquela dentre todas as que a empresa possui. Ou seja, tudo aquilo que um c√≥digo de barras em um transg√™nico precisa ter.

Código de Barras no DNA

Imagem modificada retirada de http://tinyurl.com/3g46mnj

No caso da imagem acima, o sistema bin√°rio de contagem foi utilizado, em que 1 √© a sequ√™ncia TGT e 0 √© TAC. Os n√ļmeros 1, 3 e 1 do nome da empresa, esp√©cie e constru√ß√£o g√™nica seriam consultados em banco de dados, de modo a identificar produtor do transg√™nico.

Esse tema foi at√© um projeto do iGEM, realizado pelo time de Hong Kong em 2010, cuja a grande ideia foi criar um processo que literalmente criptografa dos dados inseridos em DNA atrav√©s da a√ß√£o de uma recombinase. Al√©m disso desenvolveram um programinha que converte os dados de caracteres (char) √† n√ļmeros quatern√°rios, disso √† ATCG e depois √† uma vers√£o compactada da sequ√™ncia (Quanto maior e mais repetitivo o texto, melhor √© a compacta√ß√£o, se o texto for pequeno e pouco repetitivo a compacta√ß√£o vai fazer o trabalho oposto); vale a pena dar uma olhadinha (nesse link aqui √≥: http://2010.igem.org/Team:Hong_Kong-CUHK/Model).

Synbiobrasil no “alfabeto nucleot√≠dico” √©¬†TTAGTGCTTCGCTCACTCCTTCGGTCACTGACTCATTGAGTCCTTCGA (grande n√©!?). ūüôā

À Prova de Erros

Tanto em computadores como no sequenciamento gen√©tico erros podem acontecer, em que um 1 pode se tornar um 0 ou um A pode se tornar T (apesar de isso acontecer com muito mais frequ√™ncia no DNA). Em ambos usa-se os mesmos m√©todos que podem identificar o erro, e se for pequeno, repar√°-lo, possibilitando a leitura correta da informa√ß√£o. Esses m√©todos chamam-se Checagem de Pares e C√≥digos Convolucionais, e utilizam bits… ops, quer dizer, utilizam n√ļmeros secund√°rios usados para verificar a consist√™ncia dos dados. T√™m-se ent√£o os n√ļmeros fonte (f), que s√£o os que cont√©m a informa√ß√£o a ser lida e os n√ļmero de checagem de paridade¬†(p), estes √ļltimos t√™m valor 1 se um conjunto determinado de n√ļmeros fonte tiverem uma quantidade √≠mpar de 1s (“ums”) e zero se o contr√°rio.

Na checagem de pares o neg√≥cio funciona com n√ļmeros de checagem verificando blocos de c√≥digo.¬†Por exemplo: os n√ļmeros fonte 1001 (f1 f2 f3 f4) s√£o verificados por tr√™s n√ļmeros de checagem: p1, que verifica os tr√™s primeiros d√≠gitos, p2 que verifica a paridade do primeiro, segundo e quarto d√≠gitos, e p3 que verifica o primeiro, terceiro e quarto d√≠gitos. Temos ent√£o o seguinte c√≥digo de checagem de pares: 1001100¬†(n√ļmeros de checagem em it√°lico), pois:

  • f1(1) + f2(0) + f3(0) = p1 (1), pois se tem “um 1”
  • f1(1) + f2(0) + f4(1) = p2 (0), pois se tem “dois 1s”
  • f1(1) + f3(0) + f4(1) = p3 (0), pois se tem “dois 1s”

Durante a leitura se n√£o houver correla√ß√£o entre os n√ļmeros de checagem e fonte, √© poss√≠vel dizer onde aconteceu o erro (caso o erro n√£o seja generalizado). No exemplo foi utilizado um bloco de tamanho 4, mas ele pode ser maior, o que aumenta tamb√©m o tamanho do c√≥digo de checagem.

Utilizando C√≥digos de Convolu√ß√£o o processo √© bem parecido, mas n√£o ocorre em blocos, nele cada fn possui um pn que verifica os dois n√ļmeros fonte predecessores. Por exemplo, o n√ļmero 1011 ficaria: 11011110 (f1 p1 f2 p2 f3 p3 f4 p4), pois:

  • f1(1) = p1(1), pois se tem “um 1”
  • f1(1) + f2(0) = p2(1), pois se tem “um 1”
  • f2(0) + f3(1) = p3(1), pois se tem “um 1”
  • f3(1) + f4(1) = p4(0), pois se tem “dois 1s”

Ensinando o computador a fazer os cálculos, utilizando esses dois métodos, e fazendo a conversão de zeros e uns para nucleotídeos (e vice-versa) é possível criar um sistema de leitura do sequenciamento genético do código de barras à prova de erros, preservando a informação original inserida na célula.

DNA “Zipado”

Assim como muita coisa na biologia sint√©tica, os mesmos princ√≠pios da computa√ß√£o tamb√©m podem ser aplicados na decodifica√ß√£o de informa√ß√Ķes inseridas em DNA. O mesmo algoritmo de compacta√ß√£o de arquivos usado na computa√ß√£o tamb√©m pode ser usado para compactar as informa√ß√Ķes a serem inseridas em DNA, salvando espa√ßo, tempo de leitura e dinheiro no bolso das empresas. √Č o amplamente conhecido Algoritmo de Codifica√ß√£o de Huffman¬†(veja o link!), que se baseia no encurtamento de c√≥digos bastante frequentes de um arquivo atrav√©s de um algoritmo recursivo que constr√≥i a “√Ārvore de Huffmam“, uma ramifica√ß√£o bin√°ria de n√≥s de dados que cont√©m informa√ß√Ķes relativas √†s frequ√™ncias de caracteres. √Č preciso um pouco de conhecimento de programa√ß√£o para entender melhor como ele funciona; e isso foge um pouco do escopo desse post. Mas basta entender que voc√™ pode “zipar” as informa√ß√Ķes dentro do DNA!

Vale muito a pena conferir os links abaixo se você quiser saber mais sobre o assunto:

E até o próximo post!
Ou como se diria em 72 pares de base:
TAATTGTAGCCTACAATCGGACAATGAATGACGGAGTGCATCCTTCGTTCGGACAATGAATCGGTGAGTGTA!

As 50 empresas mais quentes de bioenergia

Acabou de sair um ranking de empresas que reconhece a inova√ß√£o e os avan√ßos em¬† bioenergia. Entre as 50, 37 s√£o dos EUA, 15 s√£o ativas no desenvolvimento do etanol celul√≥sico, 5 desenvolvem algas para solu√ß√Ķes energ√©ticas e 16 produzem novos biocombust√≠veis avan√ßados como o biobutanol,¬† biodiesel, gasolina e combust√≠veis de jato renov√°veis.

Veja a reportagem completa:

http://biofuelsdigest.com/bdigest/2010/12/07/the-50-hottest-companies-in-bioenergy-for-2010-11/

The 50 Hottest Companies in Bioenergy for 2010-11 are:

Last year’s rank (2009-10)

1.            Amyris                              3

2.            Solazyme                          1

3.           POET                                 2

4.            LS9                                    8

5.            Gevo                                 13

6.            DuPont Danisco            7

7.            Novozymes                       11

8.             Coskata                             6

9.             Codexis                            35

10.            Sapphire Energy            5

11.             Virent                              21

12.             Mascoma                        10

13.             Ceres                                28

14.             Cobalt Technologies     30

15.             Honeywell’s UOP           12

16.             Enerkem                          25

17.             BP Biofuels                        4

18.             Genencor                         26

19.             Petrobras                          18

20.             Abengoa Energy             15

21.             Qteros                                22

22.             Joule Unlimited              32

23.             Shell                                    27

24.             Bluefire Renewables        19

25.             Rentech                              38

26.             Algenol                                24

27.             ZeaChem                             20

28.             PetroAlgae                          16

29.             Neste                                    29

30.             Synthetic Genomics           17

31.             LanzaTech                            41

32.             Iogen                                    23

33.             OriginOil                             42

34.             RangeFuels                         14

35.             ExxonMobil                        29

36.             Cargill                                    NR

37.             SG Biofuels                          49

38.             Butamax                              38

39.             Terrabon                              47

40.             Cosan                                    NR

41.             Verenium                              9

42.             Waste Management            42

43.             IneosBio                                36

44.             Dynamic Fuels                     NR

45.             Fulcrum Bioenergy              48

46.             KL Energy                             34

47.            KiOR                                       NR

48.             Chevron                                 NR

49.             Monsanto                              NR

50.             Inbicon                                    50

Palestra de pesquisadora do MIT sobre biologia sintética

Nesta segunda-feira, às 10:00 no anfiteatro 2 do ICBII (no centro didático anexo) teremos o grande prazer de receber a pesquisadora do MIT Meagan Lizarazo, que falará sobre Biologia Sintética, iGEM, Registro de Partes Padrão e outras coisas interessantes.

N√£o percam!

Reuni√£o no dia 10/03, dispositivos sint√©ticos: osciladores e din√Ęmica

Ol√° pessoal, est√° confirmada para o dia 10/03, logo ap√≥s o carnaval, a nossa terceira reuni√£o do Synbio Science Club. As reuni√Ķes voltar√£o a ser na sala 101 aqui no ICBII na USP.

  • 10/03/2011, 3 pm, Oscillators & Dynamics

A Synthetic Oscillatory Network of Transcriptional Regulators. Elowitz MB, Leibler S. Nature. 403:335-8. (2000).

A fast, robust and tunable synthetic gene oscillator. Stricker J, Cookson S, Bennett MR, Mather WH, Tsimring LS, Hasty J. Nature. 456:516-19 (2008).

Nos vemos l√°!

Clube de Biologia Sintética da Universidade de São Paulo!

Agora √© oficial! Foi aprovado pelo conselho do Departamento de Microbiologia da Universidade de S√£o Paulo o nosso Clube Cient√≠fico de Biologia Sint√©tica. A partir de agora, poderemos divulgar, reservar uma sala para as reuni√Ķes e receber nossos colegas da Poli e¬†outros Institutos para discutirmos synbio!

SynbioBrasil Science Club: Participe!

Dispositivos sintéticos: interruptores de expressão gênica

S√≥ agora tive tempo para fazer um post sobre a nossa segunda reuni√£o do Clube Cient√≠fico de Biologia Sint√©tica da USP que, com certeza, vai render alguns posts.¬†¬†Conversamos sobre¬†uma das¬†primeiras constru√ß√Ķes gen√©ticas de biologia sint√©tica visando a robustez no controle de express√£o: a constru√ß√£o de um interruptor gen√©tico (toggle switch, flip flop,..).¬†Robusto porque √© capaz de funcionar corretamente a partir do modelo apesar de v√°rias incertezas do sistema.

Mas para entender o dispositivo, vou comentar alguns conceitos b√°sicos de biologia molecular: (i) promotores s√£o regi√Ķes do DNA que antecedem os genes e¬†s√£o reconhecidas pela RNA polimerase e um fator sigma associado para facilitar a transcri√ß√£o do gene, (ii) transcri√ß√£o √© processo de cria√ß√£o de um RNA complementar¬†a sequ√™ncia de DNA que posteriormente pode ser traduzido por um ribossomo a uma prote√≠na, finalmente, (iii) um repressor √© uma prote√≠na de liga√ß√£o de DNA que regula a express√£o de genes, atrav√©s da liga√ß√£o a um operador, e bloqueia a liga√ß√£o da RNA polimerase¬†no promotor,¬†impedindo a transcri√ß√£o de genes.

Utilizando esses conceitos b√°sicos de biologia molecular, Gardner e colaboradores (2000) constru√≠ram um interruptor para regular a transcri√ß√£o de genes em E. coli.¬†Chama-se um interruptor porque possuiu dois pontos de equil√≠brio (acesso ou apagado, direita ou esquerda, express√£o de X ou express√£o de Y). Vou dar o exemplo de apenas uma das constru√ß√Ķes, em que o repressor 2 (repressor LacI) reprime o promotor 2 (Ptrc-2), e o repressor (repressor Tet) reprime o promotor 1 (PltetO-1).¬† A subst√Ęncia IPTG (Indutor 2) inibe o¬†repressor 2 e¬†aTC (Indutor 1) inibe o repressor 1 (ver Figura abaixo).

Dessa maneira, basicamente, temos dois pontos de equil√≠brio: (i) com¬†a presen√ßa de aTC,¬†o repressor 2¬†√© transcrito e ocorre a repress√£o do promotor 2, n√£o havendo assim¬†a transcri√ß√£o do gene rep√≥rter (no caso uma prote√≠na luminescente GFP); (ii) e na presen√ßa de IPTG em que ocorre a transcri√ß√£o do promotor¬†2, e conseq√ľente transcri√ß√£o de GFP e do repressor 1.

Dessa maneira, existem dois estágios: aceso (transcrição de GFP) e apagado (sem transcrição de GFP). Este sistema é robusto porque funciona de acordo com o modelo proposto:

Onde u √© a concentra√ß√£o do repressor 1, v √© a concentra√ß√£o do repressor 2, őĪ1 √© a taxa efetiva de transcri√ß√£o do repressor 1, őĪ2 √© a taxa efetiva de transcri√ß√£o do repressor 2, ő≤¬†√© taxa de cooperatividade da repress√£o do promotor 2 e ő≥ √© taxa cooperatividade de repress√£o do promotor 1.¬†A a√ß√£o deste modelo corresponde a seguinte estrutura gr√°fica:

Este gráfico representa os dois pontos de equilíbrio do sistema, o estado 1 e o estado 2 (aceso e apagado, na presença de um dos indutores) e um outro ponto instável de equílibrio que mostra os dois repressores se regulando mutuamente. Seria mais fácil de entender se houvesse, de uma lado uma proteína luminescente verde e  do outro lado do dispositivo uma proteína luminescente amarela. Os estados de equilibro 1 e 2 representam verde ou amarelo, enquanto o ponto instável de equilíbrio representa a ausência de cor.

Este tipo de dispositivo pode ser utilizado na biotecnologia para regular vias metabólicas inteiras, ligando e desligando vias de acordo com um sinal externo; ou na medicina para acionar a resposta a um remédio por exemplo. Funcionam de uma maneira mais eficiente do que o controle via promotores específicos. No próximo post, vou comentar a utilização desse dispositivo para desenvolver uma bactéria que conta!

Construction of a genetic toggle switch in Escherichia coli. Gardner TS, Cantor CR and Collins JJ. Nature 403: 339-342 (2000).

Do-it-yourself biologists (DIYbio) e a ciência cidadã

ResearchBlogging.org

Neste momento, em algum lugar dos Estados Unidos, da Inglaterra¬†ou at√© da √ćndia, algum bi√≥logo sint√©tico¬†amador est√° realizando um experimento na sua cozinha ou garagem. Nos √ļltimos dois anos, entusiastas da biologia molecular t√™m se juntado¬†para montar organiza√ß√Ķes de biologia sint√©tica amadora, como o¬†DIYbio (do-it-yourself biology),¬†em que os membros¬†se re√ļnem em pubs e barbecues para discutir os √ļltimos experimentos realizados nas suas pr√≥prias garagens.¬†H√°¬†quase seis meses¬†tenho participado das discuss√Ķes desse grupo,¬†que apresentam¬†conte√ļdo refinado e objetivo sobre o desenvolvimento de microsc√≥pios de 10 d√≥lares, espectrofot√īmetros, centr√≠fugas de furadeiras ou liquidificadores, constru√ß√Ķes de¬†diferentes kits com E. coli modificada, chegando at√© a sequenciadores¬†de DNA caseiros.

Inspirados pelos grandes avanços realizados em garagens pelos fundadores de atuais gigantes da informática, os também chamados biohackers pretendem revolucionar a ciência através de experimentos e idéias não-convencionais aplicados a biologia sintética.

Este movimento tamb√©m se caracteriza pela chamada ci√™ncia cidad√£ (minha tradu√ß√£o de citizen science), em¬†que os cidad√£os¬†ativamente participam no papel de desenvolver a ci√™ncia e as novas tecnologias. Al√©m disso, a ci√™ncia cidad√£¬†estimula o apoio da popula√ß√£o¬†√†¬†ci√™ncia, o desenvolvimento do pensamento cient√≠fico nas pessoas, al√©m de introduzir novas id√©ias de diferentes disciplinas ao¬†assunto. Utilizando a Internet como plataforma, um simples projeto de ci√™ncias pode envolver dezenas, centenas e milhares de pessoas de diversas forma√ß√Ķes no mundo dispostas a criar algo novo e interessante.

Por√©m, junto com o crescimento da ci√™ncia cidad√£, tem tamb√©m aumentado a preocupa√ß√£o do governo americano e do FBI¬†a respeito do que os biohackers est√£o fazendo. Por incr√≠vel que pare√ßa, agentes do FBI¬†t√™m comparecido a reuni√Ķes do DIYbio para entender o que as pessoas est√£o fazendo e qual a possibilidade de utiliza√ß√£o das ferramentas para o¬†bioterrorismo.¬†A comunidade DIYbio teme que o foco constante em poss√≠veis atividades terroristas desvie a aten√ß√£o dos t√≥picos importantes¬†relacionados com biosseguran√ßa: como o¬†descarte de bact√©rias geneticamente modificadas,¬†normatiza√ß√£o/legaliza√ß√£o de laborat√≥rios caseiros¬†e equipamentos de seguran√ßa mais acess√≠veis e baratos.

Muitas vezes o que tem acontecido é que não existe nenhum tipo de norma ou lei que fale a respeito de laboratórios caseiros para a utilização de bactérias geneticamente modificadas.

Eu acho incrível o que está acontecendo neste momento. Não só está ocorrendo uma explosão de conhecimento e técnicas no mundo científico, mas também a população está cada vez mais interessada em fazer parte dessas descobertas e fazer da ciência um exercício cotidiano.

Ledford, H. (2010). Garage biotech: Life hackers Nature, 467 (7316), 650-652 DOI: 10.1038/467650a

Editorial, Nature (2010). Garage biology Nature, 467 (7316), 634-634 DOI: 10.1038/467634a