Enquete: Qual projeto você acha mais interessante!?

Chegamos ao fim do ano com três projetos bastante interessantes para levarmos ao iGEM e queríamos a opinião de vocês sobre qual deles vocês acham mais legal e o porquê! Deêm uma conferida num resumo super rápido de cada proposta:

Plasmídeo Plug&Play

Cansado de ter que fazer vários passos metodológicos para transformar microrganismos? Você adoraria expressar um gene que você sempre quis em sua bactéria de um jeito fácil, rápido, barato e acessível? Chegou a solução! Com apenas dois pequenos passos você tem em mãos um kit de transformação “faça-você-mesmo” (DIY), sem precisar de equipamentos e reagentes caros! Basta fazer um PCR e depois a transformação! Esqueça outros passos como digestão, ligação, e vários outros PCRs cansativos! Veja aqui o link de um vídeo sobre a proposta.

Rede de Memória Associativa em Bactérias

Imagine se fosse possível reproduzir um comportamento cerebral… sem o cérebro! Esse é um tipo de desafio que muitos cientistas da computação e programadores andam trabalhando por aí. Na Biologia Sintética também! Inspirado em algumas publicações recentes envolvendo experimentos in vitro de sistemas com comportamento de uma rede neural, queremos criar um modelo in vivo disso, e sem usar neurônios: com populações de bactérias! Elas seriam capazes de reconhecer um padrão luminoso incompleto de uma “memória” que possuem e depois completar esse padrão, dando uma saída (output) luminosa com o padrão mais próximo de sua memória em relação ao padrão inicial dado. Já escrevemos um post sobre o caminho de ligações improváveis que fizemos para chegar na ideia desse projeto. Veja aqui o link de um vídeo sobre a proposta.

Sensor de Tensão Mecânica de Membrana

Nós temos mecanismos sensoriais bem parecidos dos que existem em microrganismos. Basicamente eles podem ser: metabólitos, temperatura, luz, voltagem, e até mesmo campos magnéticos. Mas e o “tato”!? Aquele tipo de sensor que usamos a todo momento! Como fazer microrganismos traduzirem um contato físico em uma resposta (igual por exemplo à essa plantinha aqui)!? É o que propõe a ideia desse projeto. Propor um novo sensor que pretende fazer microrganismos nos contarem que os estamos tocando (através desse Biobrick, um “stretch channel”), emitindo luz azul nesse processo (através desse Biobrick, Aequorina). No final, podemos aplicar isso igual ao esquema da figura aí em cima. Veja o link de um vídeo sobre a proposta aqui (< desatualizado, mas no mínimo dá pra entender de onde veio o insight da ideia).

E aí!? O que você acha? Dê o seu pitaco!

Ligações Improváveis: RNA antisense, Sudoku e Redes Neurais

A ciência é cheia de ligações improváveis.

Veja por exemplo o estudo das partículas subatômicas e seus spins: quem diria que conhecer isso poderia permitir uma revolução na neurociência? Entendendo como o núcleo atômico dos átomos se comporta em um campo magnético foi possível construir o aparelho que permite literalmente olhar dentro de nosso cérebro, passando bem longe de um desconfortável bisturi: o aparelho de Ressonância Magnética Nuclear Funcional (geralmente os hospitais e clínicas tiram o “Nuclear” do nome porque isso assusta os pacientes; é sério!).

Chamamos essas ligações de “improváveis” principalmente por causa da sua contra-intuitividade, afinal quem pensaria em analisar o comportamento de cérebros ao se estudar algumas das menores coisas do universo!? Fazer essas pontes é o que se precisa para criar inovação, e é exatamente na busca desse tipo de coisa que nas últimas reuniões do Clube de Biologia Sintética começamos a fazer algumas ligações (não necessariamente na ordem do título) que “do lado de fora” têm uma aparência improvável, mas que no fundo talvez só sejam contra-intuitivas.

Tudo começou, ou melhor, tudo deveria ter começado (para amenizar a aparente desconexão) falando-se da mais novinha regulação de expressão gênica no mundo das descobertas científicas:

O RNA de Interferência

Representação do funcionamento dos RNAs antisense: quando se ligam à uma fita de RNA mensageiro com alto grau de complementariedade entre as fitas (diz-se "complementariedade" entre duas fitas de DNA (ou RNA) quando o código genético de ambas têm sequências de nucleotídeos que ligam-se entre si através dos pares A-T (U em RNAs) e C-G formados entre as fitas), há o bloqueiro da atuação da RNA polimerase, impedindo a tradução do RNA em proteína. Se não houver muita correspondência entre as fitas de RNA a traduação continua normalmente.

É mais uma daquelas descobertas “nobélicas”, estudada pelos pesquisadores americanos Andrew Fire e Craig Mello em 1998, ganhando o prêmio em 2006. A grande ideia dos RNAs de interferência (iRNA) é o pareamento  de pequenos segmentos de RNA – que não são codificados em proteínas – com RNAs mensageiros, impedindo que sejam traduzidos por “bloquear” o ribossomo . Esse sistema de inibição gênica envolve várias enzimas (se quiser saber mais veja esse ótimo vídeo) e é um pouco mais complexo do que o sistema de regulação gênica daquilo que chamamos de RNA antisense, mas na essência funcionam do mesmo jeito: bloqueio da tradução através de um RNA antisense complementar. A grande diferença entre os RNAs antisense e os de interferência, que são comumente confundindos com sinônimos, é que os iRNA atuam através de toda uma via de reações enzimáticas em eucariotos, enquanto os RNA antisense são mais característicos de seres procarióticos e não precisam de uma via enzimática para regularem a expressão gênica.

Diferentemente dos outros tipos de regulação mediados por inibidores, que são basicamente proteínas que se ligam ao DNA inibindo a transcrição gênica, com os RNAs antisense têm-se uma gama muito maior de inibidores da expressão gênica. Imagine que você quer controlar uns 2 ou 3 genes em uma bactéria: existem muitos metabólitos que podem fazer esse trabalho (por exemplo IPTG, galactose, TetR e etc.), mas e se você quiser ter um controle de mais genes, digamos, uns 20!? Dá-lhe repressores! Por outro lado, se for possível usar RNAs de interferência suficientemente eficientes, poderia se fazer um vetor de transformação bem mais enxuto (em relação aos sítios repressores) além de poder construir um mecanismo de repressão mais orientado ao “alvo” de repressão: basta construir um RNA mensageiro complementar. É exatamente essa versatilidade que torna possível contruir uma…

 Bactéria Resolvedora de Sudoku

Legal: Sudoku, Bactérias e RNA antisense… O que essas coisas têm a ver!?

Essa grande ideia veio do time japonês UT-Tokyo do iGEM de 2010, e além de usar RNAs antisense, também usou do dispositivo gênico baseado em recombinases semelhante ao que o time da Unicamp usou em 2009 para a mesma finalidade, que é diferenciar diferentes populações de bactérias. O sistema que eles criaram funciona basicamente assim:

Populações Diferentes

Diferentes tipos de Populações

Eles representaram (em um sudoku 4×4) cada posição por uma população específica de E.coli’s. Cada posição tem algo em seu DNA que a torna diferente de todas.

Diferentes Estados

Estados das Populações

Cada população pode se diferenciar em quatro tipos diferentes de E.coli’s correspondentes à cada número que um sudoku 4×4 permite (1, 2, 3 e 4).

Comunicação entre as Posições (Populações)

Comunicação viral entre as posições (populações) do sudoku

As populações devem se comunicar para transmitir a informação de suas posições para as outras posições; afinal é assim que se resolve um sudoku: podemos dizer que uma posição é 1, 2, 3 ou 4 depois de recebermos as informações de quais números existem no quadrado, linha e coluna correspondente à posição em questão.

Essa comunicação é feita através de vetores virais, que são vírus que as bactérias produzem para infectar as outras populações correspondentes às outras posições, transmitindo as informações que possuem (como sua “posição” e “estado”: 1, 2, 3 ou 4).

Diferenciação dos Estados

Diferenciação dos estados

Para o sudoku funcionar, quando uma posição identificar qual é o estado de suas vizinhas, ela deve se diferenciar justamente no estado que não recebeu sinal. Por exemplo (imagem ao lado), se a posição (1,1) (linha 1, coluna 1) receber as informações de que certas posições em seu quadrado, linha e coluna já estão diferenciadas nos estados 3, 2 e 1, ela deve se diferenciar em 4. Para conseguir fazer isso, os japoneses usaram o dispositivo chamado “4C3 leak switch”, que se baseia na probabilidade de uma polimerase em “ignorar” os sítios terminadores de transcrição. Para entender melhor, veja a imagem abaixo:

Cada gene codifica um tipo de recombinase (as setinhas apontando para a esquerda: Hin, flpe, Ligand 3 e Ligand 4). Quando a E.coli for infectada por um vírus de uma posição com que se comunica, ele inserirá um plasmídeo que expressa uma dessas 4 recombinases, agindo nas posições que flanqueam o mesmo gene na bactéria. Por exemplo, na imagem da diferenciação dos estados, a posição (2,2) envia um vírus à (1,1) passando a informação de que possui o estado “2”, expressando a recombinase flpe e retirando o respectivo gene do plasmídeo bacteriano através das posições FTR que flanqueiam o gene (ver imagem acima). Ao fazer isso, também retirará o sítio terminador que fica entra os FTR, aumentando a probabilidade da polimerase atravessar todas as sequências de recombinases de sequências invertidas e expressar a cre recombinase (setinha cinza apontando para a direita). Depois, se a posição (1,1) receber mais dois vírus diferentes, ele perderá 3 genes de recombinase e três sítios terminadores, restando apenas um sítio terminador entre o promotor pT7 e o gene cre. Nesse estágio, a probablilidade de a polimerase ultrapassar o sítio terminador (daí que vem o “leak”) é considerável, e quando o faz, transcreve a cre recombinase, que retira seu próprio gene e os dois sítios terminadores duplos depois dele, conectando o gene de recombinase que não foi retirado do plasmídeo junto dos genes que também estão em sentido reverso, transcritos pelo promotor pSP6. Além disso promove a produção de vírus através da retirada dos dois sítios de parada que separam o segundo promotor pT7  do gene que transcreve a polimerase que atua no promotor pSP6 e o gene que produz o capsídeo do vírus. O empacotamento das sequências genéticas no vírus acontecem após a loading sequence (retângulo rosa). Isso faz com que a posição 1 passe também a “emitir” vírus informando seu estado e posição.

Para entender de verdade, vale assistir o vídeo (começa mesmo aos 24 seg) que o próprio time japonês fez para mostrar o funcionamento do sistema (percebam o sotaque!):

Restrição de Posições

Para isso dar certo é preciso que somente as populações da respectiva linha, coluna e quadrado comuniquem-se entre si, ou seja, deve have uma restrição à comunicação entre as populações de posições não-relacionadas segundo o sudoku. Como isso é feito!? Sim! RNAs antisense!

Tudo isso só consegue funcionar graças à atuação dos RNAs antisense que coordenam o fluxo de informação entre as diferentes populações associadas às diferentes posições do sudoku. Na imagem do 4C3 leak switch são as location sequence que contém todas as sequências codificantes dos RNAs de interferência de cada posição. Com isso é possível construir uma tabela de correspondência de antisense que dirá quais antisense uma posição deve fazer para inibir a atuação dos vírus de outras posições não-relacionadas:

Mas espera aí! O sudoku é uma tabela 2D, como é possível separar as diferentes populações, uma em cada posição característica, e assim fazer a transferência de informação!? É preciso construir algo físico – uma tabela de sudoku de verdade – para esse sistema sintético!? Resposta: não é preciso “separar” as populações, a interação entre os RNAs antisense dos vírus de cada população que remete à uma posição dá conta do recado. Você pode misturar todas a populações em um tubo de ensaio (com o input, é claro) e depois analisar os estados de cada bactéria pertencente à um tipo de população (por sequenciamento) e assim saber o resultado do sudoku.

Esse conceito de restrição de informação por RNAs antisense, e esse fluxo de informação por vírus é essencial para se entender o que estávamos discutindo no clube de biologia sintética, sobre como fazer em um sistema bactériano uma…

Rede Neural

Por fim: rede neural! Como fazer um dispositivo biológico sintético que imite uma rede neural!?

Bem, abstratamente falando, uma rede neural pode ser simbolizada através da imagem ao lado: os neurônios (as bolinhas) e suas ligações. O que temos em comum entre esses sistema e o sudoku são que temos posições espaciais trocando informações e seguindo um padrão. No sudoku o que restringe o fluxo de informação são as regras que pré-estabelecemos para o jogo, no sistema neuronal o que restringe a comunicação é apenas o espaço (existe um número finito de ligações axônicas que os neurônios podem fazer devido à limitação de espaço), além de outro fator: o “peso” dessas interações, que associa uma intensidade de fluxo de informação entre neurônios (o aumento desses “pesos” durante o tempo devido a um estímulo é o que chamamos de aprendizado).

Rede de Hopfield

Para querer fazer o design de um sistema sintético que se comporte como uma rede
neural devemos usar um modelo que represente uma rede neural! Existem vários deles, mas um mais simples e talvez o mais interessante para usarmos é a Rede de Hopfield, muito usada em computadores para reconhecimento de padrões. Hopfield é chama de uma rede de memória associativa pois consegue armazemar memória através da associação de informações existentes na comunicação entre vários neurônios. Uma das implicações disso é a capacidade de recuperar esse padrão mesmo quando dado um padrão incompleto.

Exemplo do Funcionamento

Imaginemos que, semelhantemente ao sudoku, também tenhamos uma matriz com posições, só que agora 3×3 e tendo apenas dois estados: “preenchida” ou “ativada”(denotada por 1), e “não-preenchida” ou “inativada” (denotada por 0). Podemos construir então “letras” preenchendo essas posições. Queremos que nosso sistema reconheça o padrão incompleto dessas letras e complete-o com sua memória:

Legal, mas como funciona o algoritmo disso!? Basicamente é com a definição das conexões que esses dois padrões têm. Partindo da hipótese que somente as posições próximas podem se comunicar (assim como neurônios, em um modelo simplificado), no padrão que pré-estabelecemos para o sistema, a comunicação entre duas posições preenchidas é considerada excitatória, ou seja, uma posição influencia a outra a permanecer ativada; já quando uma posição não-preenchida se comunica com uma preenchida, a comunicação é considerada inibitória; e por fim, quando duas posições não-preenchidas estão uma ao lado da outra, há indiferença e não há ativação ou inibição entre si (ver imagem abaixo). Com isso podemos criar uma rede de comunicação  característica de cada figura com os pesos dos padrões.

Para a rede reconhecer ambos os padrões, deve-se somar os pesos dos padrões L e T:

Cada peso de comunicação da soma dos pesos é computada para reestabelecer um dos padrões da memória dado um padrão incompleto. Vejamos o exemplo da imagem abaixo: um L incompleto. Para decidir se a posição não-preenchida se preencherá é preciso computar o padrão incial em relação aos pesos na “memória da rede” com a expressão abaixo, em que wik é o peso da interação entre a posição em questão (denotada por i) e uma determinada posição k.

Então somando-se os produtos entre os estados xk (das k posições comunicando-se com a posição incompleta) e os pesos wik das interações entre as k posições e a posição incompleta, define-se o estado que a posição incompleta deve ter: se é de fato um estado inativado ou ativado (preenchido):

x(3,1) = 1 . 1 + 0 . 1

x(3,1) = 1

Portanto, segundo a interação associativa da rede, a posição (3,1) torna-se em um estado ativado (1) completando a letra L. Para diferentes inputs o cálculo é o mesmo e (com algumas exceções) o sistema sempre se ajusta à um dos dois padrões de sua memória: ou um L ou um T.

Como Fazer isso com Bactérias

Assim comom no sudoku, podemos criar diferentes populações de bactérias para cada posição além de – pelo mesmo mecanismo – uma rede de transmissão de RNAs antisense por vírus baseando-se na tabela de pesos das interações entre as populações existentes (a “memória” do sistema), de modo que cada posição tenha os antisense corretos para reprimir ou estimular a produção de uma determinada proteína repórter para cada posição! O que se diferenciaria do sudoku é que precisaríamos construir um aparelho literal do sistema que queremos construir, ou seja: é preciso separar as diferentes populações para discernir os outputs para saber ao certo qual população referente emitiu luz verde por GFP, por exemplo. O input também poderia ser luz, feito através de um light switch.

E assim o ciclo das relações um tanto improváveis se fecha. Mas como a ciência é extremamente mutável vários outros assuntos podem se juntar nessa ciranda e dar origem a outras “improbabilidades”. Você, leitor, também pode fazer parte desse trabalho ou pelo menos acompanhar de perto e conhecer um pouco melhor sobre essas coisas que andam rolando nas discussões do clube de biologia sintética através das reuniões gravadas, em especial (sobre como fazer uma rede neural artificial em bactérias)  essa aqui no nosso canal no LiveStream.

Quem sabe possamos colocar em prática tudo isso!? Vejamos em 2012!

Brasil no iGEM

Para quem acha, não somos o primeiro grupo a ambicionar ir a um evento do iGEM. Lá pelos idos de 2009 o Brasil participou pela primeira vez da competição representado pela Unicamp, conseguindo trazer aqui para o lado de baixo do hemisfério uma medalha de ouro já “de cara”, equiparando-se às universidades mais renomadas do mundo, como Cambridge, Harvard e outras.

Sob o projeto intitulado “Microguards”, o time brasileiro criou um mecanismo de transformação de E.Coli’s e de leveduras  (S. Cerevisiae) em “micro guardas”, que atacam bactérias contaminantes de biorreatores de etanol, no caso as bactérias do gênero Lactobacillus (do tipo daquelas que regulam a sua ação intestinal quando você bebe o seu leite fermentado – Yakult, Chamyto, e etc -). Usar um mecanismo como esse na indústria brasileira evitaria o atual desperdício de milhares de litros de álcool que deixam de ser produzidos por causa do açúcar consumido pelos microorganismos invasores nos bioreatores de etanol. Cerca de 5 à 10 % da produção é desperdiçada por causa desses ladrõezinhos.

O Mecanismo

Reconhecimento

“ColiGuards”

Criando uma espécie de “sistema imune de bioreatores”, duas linhagens de E.coli’s são criadas no meio de cultivo: a linhagem natural chamada de workers linage e a linhagem de “microguards”, ou killers linage; a população dos dois tipos de linhagem varia dependendo do grau de contaminação do meio, ou seja, quando não há contaminantes, muito poucas bactérias workers transformam-se em killers e vice-versa.

A transformação em killers é ativada por, um metabólito secundário de quorum sensing, AI-2 (se quiser saber mais clique aqui),  que é liberado tanto pela bactéria contaminante quanto pelas E.Coli’s selvagens, é reconhecido pelas E.Coli workers, que não produzem AI-2, o que as induz a diferenciarem-se em killers. Além disso elas podem detectar os contaminates através da conjugação bacteriana com os microorganismos invasores, abilidade que só as killers passam a ter no processo de diferenciação, utilizando-a apenas naqueles microorganismos que possuem um plasmídeo diferente do seu (veja “recognition by conjugation” aqui).

“YeastGuards”

Para as Leveduras o mecanismo de reconhecimento da presença de contaminantes é um pouco mais simples: a produção de lactato provinda do consumo de açúcar dos Lactobacillus é utilizada para ativar gatilhos gênicos – o que somente é possível através da sensibilização das leveduras ao lactato, utilizando uma permease expressa pela levedura para facilitar sua incorporação à célula – que induzem um ataque aos contaminantes.

Diferenciação

Os brasileiros aproveitaram o elegante design feito pelo time francês da universidade de Paris no iGEM de 2007 para criação de um sistema de diferenciação das E.Coli’s em microguards. Com a atuação de uma recombinase (a cre recombinase),  parte dos genes do plasmídeo que transforma o microorganismo sofre excisão, tornando-se um pequeno pedaço de DNA circular com baixa taxa de atividade e sem origem de replicação, enquanto os outros genes que permaneceram no plasmídeo passam a se tornar ativos devido ao seu reposicionamento na fita de DNA logo após um promotor, como pode ser visto na imagem logo abaixo:

Lox71 e lox66 são os sítios do DNA onde atuam as cre recombinases (atuação simbolizada pelo raio vermelho). Após sua ação, os genes após as regiões de terminação (T) são reposicionados - no caso do exemplo o gene dapA - próximos ao promotor que antes era da região excisionada (na imagem o promotor Tet), e por isso tornam-se ativos.

O controle populacional dos microorganismos killers é mantido através do gene ftsK da imagem acima: um gene que produz uma proteína determinante na divisão celular, sendo uma “máquina literal de segregação de cromossomos”. Dessa maneira, evita-se que a população de killers cresça demais e se torne um “tiro pela culatra”, diminuindo a produção de etanol.

Outro aspecto bastante interessante da construção das ColiGuards é o mecanismo de controle de uma população basal de killers em um biorreator não contaminado. Eles usaram uma criativa construção feita por outro time do iGEM, o de Caltech de 2008, que se aproveitou de uma “falha” da atividade da DNA-polimerase para randomizar a expressão de um gene em uma população bacteriana. Essa “falha” é a característica que a polimerase possui de ignorar ou repetir algumas sequências de nucleotídeos que são repetidas longamente no código, produzindo uma cópia de DNA com um número variável dessas repetições (fenômeno chamado de SSM, do inglês: slipped-strand mispairing), a consequência disso é que a sequência codificadora (o gene) pode ser deslocada da posição correta em relação ao seu start codon se as repetições não forem múltiplas de 3 (porque cada códon é constituído de 3 nucleotídeos), e assim a tradução não é feita corretamente. Veja figura abaixo:

As letras maiúsculas correspondem cada uma a um aminoácido, traduzido por um códon (grupo de três nucleotídeos). ATG é o start codon e TAA é um codon de parada formado pelo deslocamento da sequência codificadora. Repare que após uma SSM, uma repetição foi omitida.

Assim, as replicações de DNA que tiverem as repetições múltiplas ATGC múltiplas de três, terão o ajuste correto da região codificadora em relação ao start códon e a tradução correta da cre recombinase será possível:

Alguns tipos de Slipped Strand Mutation que podem acontecer na população de E.Coli's.

Como esse tipo de erro da DNA-polimerase não é tão frequente, apenas uma pequena parte da população se diferenciará em killer se as repetições forem colocadas antes do gene da cre recombinase.

Para diferenciar bactérias workers na vizinhança de contaminantes, todos os microguards possuem uma outra cópia do gene recombinase, mas controlado por um promotor sensível ao AI2 liberado pelos Lactobacillus e pelas Coliguards quando detectam a presença dos invasores (figura ao lado).

Mecanismo de Ataque

Os mecanismos de ataque aos contaminantes que os Microguards possuem são divididos em três tipos: a liberação de substâncias nocivas ao  Lactobacillus, a conjugação de um plasmídeo contendo genes que provocam a morte celular do invasor, e a estratégia kamikaze: quando se libera uma grande quantidade de substâncias que são nocivas ao Lactobacillus e levam o microorganismo à lise (ver figura abaixo). A Yeastguard possui em seu arsenal somente o primeiro mecanismo, enquanto a Coliguard dispõe dos três no combate aos invasores. Essa desigualdade beligerante entre os dois microorganismos, segundo o próprio grupo (veja a parte dois do vídeo no final do post), não foi uma discriminação proposital às Leveduras: se deu mais à falta de tempo para implantar e documentar a maquinaria funcionando nas Leveduras até o congelamento da wiki do grupo. Competições têm dessas coisas!

A construção desses mecanismos de ataque aproveitou-se da maior diferença estrutural entre as E.coli’s e Leveduras, e o Lactobacillus:  a coli é uma bactéria Gram negativa (possui duas membranas celulares, existindo entre elas uma fina parede celular) e o invasor é Gram positivo (possui apenas uma parede celular no exterior e uma membrana celular interior do compartimento celular), enquanto a parede celular das leveduras é constituída de carbohidratos, diferentemente dos peptídeoglicanos do contaminante. Sabendo disso, o grupo resolveu expressar substâncias que ataquem a parede celular de peptídeoglicanos exposta dos  Lactobacillus e encontraram as lisozimas como a arma perfeita para isso, sendo usadas tanto na secreção como no método kamikaze.

O grande problema dos métodos de secreção é que eles podem se comportar como contaminantes, além da consequente redução do grau de efetividade da enzima durante o tempo devido à seleção natural. A solução encontrada para esse problema foi a conjugação de um plasmídeo (lembrando que somente as killers têm a abilidade de conjugação!) com o gene de uma endonuclease, a colicina, destruindo os Lactobacillus “por dentro”. Para que as próprias E.coli’s não fossem afetadas por esse gene letal, foi inserido um gene de resistência que torna a expressão de colicina inofensiva às Coliguards.

iGEM 2009

Melhor do que descrever como foi o projeto, nada melhor do que as próprias pessoas que participaram do evento para explicarem o que fizeram! Confira a apresentação do grupo brasileiro no Jamboree realizado em 2009 no MIT:

E nesse ano há outro time em associação com a universidade francesa de Saint-Etienne, com o projeto intitulado “Stress Wars”. Confira o que já está sendo feito nesse novo projeto franco-tupiniquim grupo junto aos outros links interessantes logo abaixo:

E a USP? Quando entrará nessa também!?
Aguardemos!

DNA como Código de Barras

DNA barcodeDesde o incrível advento do sequenciamento gênico lá pelos idos dos anos 70 o volume de dados obtidos das mais variadas combinações de nucleotídeos encontradas na natureza é estonteante. Fazendo um cálculo bem simples com só cinco nucleotídeos, temos 3125 combinações diferentes das letrinhas A,T,C e G!

É lógico que hoje também conhecemos uma enorme quantidade de padrões dessas letrinhas que nos dizem: “Olha, aqui termina um gene!”, ou “É aqui que o ribossomo gruda!”, entre outras coisas. O ruim é que só à partir do DNA é bem mais trabalhoso e difícil dizer de qual criatura vieram aquelas informações encriptadas ali quando comparada à mera observação daquele ser vivo. E em alguns casos, mesmo que se conheça de onde vem o DNA, há a dúvida se ele veio mesmo de onde parece ter vindo: como se poderia ter certeza, por exemplo, se aquela bonita carteira de couro que te deram de presente não veio de uma espécie de jacaré em extinção em vez de um réptil criado em cativeiro!? A grande ideia é fazer o mesmo que você faz quando vai ao supermercado: em vez de escanear cada dobra da embalagem, abri-la, fazer uma fina análise do conteúdo, além de ter que sair por aí perguntado quanto custa, basta colocar aquela figurinha cheia de barras que existe em algum canto da embalagem num detector e pronto! Você passa a saber com rapidez do que se trata aquilo. No código genético tenta se fazer a mesma coisa.

A Vida Rotulada

A região do DNA (lócus) que deve ser usada para ser um “código de barras” (CB) tem que ao mesmo tempo ser conservada e variável, do mesmo modo que os CB’s são todos barrinhas pretas de mesmo tamanho, mas com comprimentos e espaçamentos variáveis. Essa região pode variar com os reinos dos seres vivos, mas no caso dos eucariotos, a região de 648 pares de bases do DNA mitocondrial que codifica a subunidade 1 da enzima citocromo mitocondrial C oxidase, é hoje amplamente usada como código de barras. O DNA mitocondrial é ideal para ser usado como CB uma vez que sua taxa de mutação nos seres vivos durante a evolução é muito alta, o que resulta em uma variação significativa das sequências entre as espécies.

Rotulando uma parte pelo todo é muito mais fácil para os biólogos associarem uma marca única de cada espécie às suas já elaboradas classificações do zoológico da vida, além de tornar muito mais fácil o controle, detecção e proteção de várias espécies de animais. Exitem grandes bancos de dados com um número crescente de DNA Barcodes (códigos de barras de DNA), um dos mais notórios é o projeto International Barcode of Life (Com site muito bonito aliás!) que já conta – pelo menos até agora pouco quando dei uma olhada – cerca de 1 milhão e 330 mil espécies no catálogo.

Código de Barras Literal

Aqui é o ponto em que a biologia sintética, ou pelo menos a engenharia genética, entra nisso tudo: como rotular os transgênicos? Bem, esse é um probleminha que foi bem discutido nos últimos anos que se passaram, principalmente porque as indústrias não queriam facilitar que sua tecnologia fosse copiada por outras companhias, enquanto governos e opinião pública queriam uma regulamentação que gerassem medidas que discriminassem um produto transgênico de um não-transgênico – um pouco por motivos ideológico-sociais, mas principalmente por motivos ecológicos: tornando a possibilidade de rastrear os culpados na hipótese de uma contaminação em certeza, haveria uma maior pressão para execução adequada das medidas de segurança impostas pela lei.

Foi aí então que criaram – ou melhor patentearam – uma padronização para códigos de barras bem interessante, que além de naturalmente tornar a identificação do transgênico muito mais fácil à partir de uma simples amostra de DNA, mantém a tecnologia em segredo e ainda conta com os mesmos processos utilizados em computador para correção de dados e compactação dos mesmos. Além dessa padronização que iremos explicar adiante, o próprio pessoal do Registro de Partes Padrão desenvolveu um Barcode para os Biobricks, que não é tão sofisticado, mas que corresponde à sua finalidade.

Escrevendo Com Quatro Letras

Para escrever textos com apenas quatro letras é muito simples se você sabe escrever

Imagem modificada retirada de http://tinyurl.com/3g46mnj

letras com números. Os computadores usam uma tabela que traduz o valores numéricos (ou melhor, bits) associados à um caractere do alfabeto alfanumérico: a famosa tabela ASCII. Para escrever letras no DNA então é muito mais fácil que no computador, principalmente porque ele utiliza o sistema binário de contagem, enquanto no DNA é possível usar o quaternário, com os 4 “números” possíveis: A, T, C e G, valendo 0, 1, 2, e 3 respectivamente (ver figura ao lado).

Com isso foi possível criar a seguinte (ver imagem abaixo) construção não-codificante de DNA que conta com informações relativas à por exemplo o nome da companhia, a espécie que foi modificada, ao ano em que o transgênico foi construído, e qual construção é aquela dentre todas as que a empresa possui. Ou seja, tudo aquilo que um código de barras em um transgênico precisa ter.

Código de Barras no DNA

Imagem modificada retirada de http://tinyurl.com/3g46mnj

No caso da imagem acima, o sistema binário de contagem foi utilizado, em que 1 é a sequência TGT e 0 é TAC. Os números 1, 3 e 1 do nome da empresa, espécie e construção gênica seriam consultados em banco de dados, de modo a identificar produtor do transgênico.

Esse tema foi até um projeto do iGEM, realizado pelo time de Hong Kong em 2010, cuja a grande ideia foi criar um processo que literalmente criptografa dos dados inseridos em DNA através da ação de uma recombinase. Além disso desenvolveram um programinha que converte os dados de caracteres (char) à números quaternários, disso à ATCG e depois à uma versão compactada da sequência (Quanto maior e mais repetitivo o texto, melhor é a compactação, se o texto for pequeno e pouco repetitivo a compactação vai fazer o trabalho oposto); vale a pena dar uma olhadinha (nesse link aqui ó: http://2010.igem.org/Team:Hong_Kong-CUHK/Model).

Synbiobrasil no “alfabeto nucleotídico” é TTAGTGCTTCGCTCACTCCTTCGGTCACTGACTCATTGAGTCCTTCGA (grande né!?). 🙂

À Prova de Erros

Tanto em computadores como no sequenciamento genético erros podem acontecer, em que um 1 pode se tornar um 0 ou um A pode se tornar T (apesar de isso acontecer com muito mais frequência no DNA). Em ambos usa-se os mesmos métodos que podem identificar o erro, e se for pequeno, repará-lo, possibilitando a leitura correta da informação. Esses métodos chamam-se Checagem de Pares e Códigos Convolucionais, e utilizam bits… ops, quer dizer, utilizam números secundários usados para verificar a consistência dos dados. Têm-se então os números fonte (f), que são os que contém a informação a ser lida e os número de checagem de paridade (p), estes últimos têm valor 1 se um conjunto determinado de números fonte tiverem uma quantidade ímpar de 1s (“ums”) e zero se o contrário.

Na checagem de pares o negócio funciona com números de checagem verificando blocos de código. Por exemplo: os números fonte 1001 (f1 f2 f3 f4) são verificados por três números de checagem: p1, que verifica os três primeiros dígitos, p2 que verifica a paridade do primeiro, segundo e quarto dígitos, e p3 que verifica o primeiro, terceiro e quarto dígitos. Temos então o seguinte código de checagem de pares: 1001100 (números de checagem em itálico), pois:

  • f1(1) + f2(0) + f3(0) = p1 (1), pois se tem “um 1”
  • f1(1) + f2(0) + f4(1) = p2 (0), pois se tem “dois 1s”
  • f1(1) + f3(0) + f4(1) = p3 (0), pois se tem “dois 1s”

Durante a leitura se não houver correlação entre os números de checagem e fonte, é possível dizer onde aconteceu o erro (caso o erro não seja generalizado). No exemplo foi utilizado um bloco de tamanho 4, mas ele pode ser maior, o que aumenta também o tamanho do código de checagem.

Utilizando Códigos de Convolução o processo é bem parecido, mas não ocorre em blocos, nele cada fn possui um pn que verifica os dois números fonte predecessores. Por exemplo, o número 1011 ficaria: 11011110 (f1 p1 f2 p2 f3 p3 f4 p4), pois:

  • f1(1) = p1(1), pois se tem “um 1”
  • f1(1) + f2(0) = p2(1), pois se tem “um 1”
  • f2(0) + f3(1) = p3(1), pois se tem “um 1”
  • f3(1) + f4(1) = p4(0), pois se tem “dois 1s”

Ensinando o computador a fazer os cálculos, utilizando esses dois métodos, e fazendo a conversão de zeros e uns para nucleotídeos (e vice-versa) é possível criar um sistema de leitura do sequenciamento genético do código de barras à prova de erros, preservando a informação original inserida na célula.

DNA “Zipado”

Assim como muita coisa na biologia sintética, os mesmos princípios da computação também podem ser aplicados na decodificação de informações inseridas em DNA. O mesmo algoritmo de compactação de arquivos usado na computação também pode ser usado para compactar as informações a serem inseridas em DNA, salvando espaço, tempo de leitura e dinheiro no bolso das empresas. É o amplamente conhecido Algoritmo de Codificação de Huffman (veja o link!), que se baseia no encurtamento de códigos bastante frequentes de um arquivo através de um algoritmo recursivo que constrói a “Árvore de Huffmam“, uma ramificação binária de nós de dados que contém informações relativas às frequências de caracteres. É preciso um pouco de conhecimento de programação para entender melhor como ele funciona; e isso foge um pouco do escopo desse post. Mas basta entender que você pode “zipar” as informações dentro do DNA!

Vale muito a pena conferir os links abaixo se você quiser saber mais sobre o assunto:

E até o próximo post!
Ou como se diria em 72 pares de base:
TAATTGTAGCCTACAATCGGACAATGAATGACGGAGTGCATCCTTCGTTCGGACAATGAATCGGTGAGTGTA!

Inside iGEM: Eventos Passados

iGEMA competição surgiu oficialmente em 2005, resultado do período de atividades independentes (AIP) do MIT, em que a universidade, assim como muitas outras, abre as portas para cursos fora do período letivo, na época de férias.  Respectivamente nos anos de 2003 e 2004, times de estudantes do próprio MIT desenvolveram osciladores biológicos com proteínas-repórter fluorescentes (como vimos aqui no blog) e sistemas genéticos para criar padrões celulares (Imagem abaixo) como os de “pontinhos” (chamados de polka dots)  e de “alvo” (chamados de bull’s eye formation).

Polka Dots, Bull's Eye formations e o Coliroid Film

Ainda em 2004, junto com as atividades do AIP, foi criada a “Summer Competition”, uma competição à lá iGEM mas com apenas cinco universidades participantes, todas norte-americanas:Boston University, Caltech, o próprio MIT, Princeton University e a University of Texas  at Austin; foi a primeira verdadeira competição de biologia sintética.O grande destaque dessa competição pré-iGEM foi a universidade do Texas, que segundo a página da competição criou o primeiro filme fotográfico biológico do mundo, o “Coliroid Film” (Imagem acima).

Esse evento acabou impulsionando Randy Rettberg, Tom Knight e Drew Endy a fundarem em 2005 o evento internacional que conhecemos hoje, com cerca de 13 times, com os mais variados projetos.

Destaques

Desde o período de atividades independentes de 2004 até 2010, 434 times e projetos já participaram da competição, com idéias e soluções  criativas e inovadoras para problemas da humanidade, o que torna difícil apresentar todos os destaques das competições além dos finalistas e vencedores do Biobrick Trophy.

Logo no início, em 2005, enquanto a competição ainda estava engatinhando e os critérios de julgamento ainda não estavam bem consolidados, não houve um BioBrick Trophy e houveram até algumas premiações um tanto não-convencionais em comparação aos iGEM’s que se seguiram, como o “Best ‘Show Must Go On’ Moment” dado à Princeton, o “George W.Bush Geography Award” (provavelmente uma brincadeira envolvendo as gafes geográficas do ex-presidente norte-americano) dado à universidade de Zurique, e o “Best Project Name” dado  à universidade de Toronto devido ao trocadilho com o nome do time e o projeto: “Cell-See-US”, que desenvolveu um tipo de termômetro com bactérias, fazendo uma analogia à unidade Celsius de medida de temperatura.

Alguns destaques interessantes da competição desse ano foram:

  • Harvard: Criaram componentes que escrevem e apagam para um “caderno de desenho bacteriano”, utilizando luz e calor para respectivamente induzir a expressão e degradar proteínas repórter em uma placa.
  • UCSF (Universidade da Califórnia, São Francisco): Desenvolveram termômetro biológico programável, apesar de início, segundo a wiki de 2006, ambicionarem apenas um detector biológico de temperatura. Ganhador do primeiro “Best Device Award” do iGEM.
  • Penn State: Construiram um mecanismo genético de controle quimiotáxico usando BioBricks. Ganhador do “Best Brick Award”.
À partir de 2006 a competição passou a contar com o Bibrick Trophy, e com grande parte das regras de hoje. Um overview desde esse ano até hoje conta com os seguintes times que despontaram com os melhores projetos em cada ano:
(Clique no logo das universidade para ir para a wiki de cada projeto)
Terceiro Lugar Segundo Lugar Vencedor
2010
2009
2008
2007
2006

Durante a avaliação dos projetos são escolhidos 5 finalistas, dentre eles figuram com frequência a Imperial College of London e UC Berkeley, além das famosas como Cambridge e Harvard. Fama também o que a Universidade da Eslovênia – do modesto país europeu – tem ganhado com essa competição: três vezes campeã e uma vez entre os 5 finalistas em 2007; contrariando a expectativa de reproduzir o ranking das melhores universidades do mundo, o que é confirmado pela forte presença das universidades asiáticas como a de Peking e a USTC.

É nesse ambiente plural e rico cientificamente (e porque não culturalmente?) em que florescem os projetos em biologia sintética mais impressionantes e competitivos todos os anos, mas muita coisa mudou desde 2006, e é sobre isso que vamos falar no próximo post da série Inside iGEM: O Futuro e Hoje.

Por falar em futuro, e o país do futuro? Onde entra nessa história!? Nós aqui da usplândia não somos os primeiros a pensar no iGEM. Veremos também a participação tupiniquim representada pela Unicamp em 2009 e agora em 2011. Então, até o próximo post!

iGEM Videos

Antes do segundo post da série “Inside iGEM” que vem por aí no blog, nada melhor do que ouvir os próprios estudantes dos times participantes para descobrir como foram algumas das edições passadas. E o melhor, em vídeos feitos por eles mesmos!

Talvez o que mais mostre a experiência do que foi ter participado na elaboração de um projeto para a competição, no melhor espírito que os alunos de Graduação especialmente têm, seja o do time da Universidade de Southtampton de 2009.

The iGEM experience:
[youtube=http://www.youtube.com/watch?v=13SVRfxGZko]
(Repare de 1:50 a 2:10!)

É claro que quando se encabeça um projeto, deve-se saber como “vender o próprio peixe”. Há vários vídeos extremamente bem explicativos no YouTube, além da própria wiki dos times, que explicam o que é o projeto e mostram sua aplicabilidade (veja alguns links no final do post), mas particularmente, o da Universidade de Edinburgo, com as suas E.Coli’s “MineBusters”, é o mais original já feito (até agora) para o iGEM. Dêem uma olhada:

The MineBusters:
[youtube=http://www.youtube.com/watch?v=QLsmjL3RIKw]

Além da concepção do projeto, a criatividade e bom humor (sem falar no talento) fazem parte de muitos times da competição. Outro vídeo musical, feito pelo time de Cambridge de 2010, mostra o drama da inserção de genes em um vetor (um plasmídeo) solucionado através do uso da técnica de Gibson Assembly (Técnica que une dois fragmentos de DNA, notável pelo número e tamanho de fragmentos que pode associar com apenas uma única reação). Uma ótima canção para você cantar aos seus colegas de laboratório (mas só se você cantar bem como a garota do vídeo!).

The Gibson Assembly Song:
[youtube=http://www.youtube.com/watch?v=WCWjJFU1be8&feature=related]

Links para outros vídeos interessantes:

Inside iGEM: A Competição

Esse é o primeiro da série de três posts “inside iGEM”, em que vamos mostrar um pouco mais a fundo sobre o que é a competição e como ela funciona.

A Inscrição

Tudo começa com a inscrição de um time, que pode ser composto por estudantes de graduação de várias áreas: desde matemática aplicada até a própria Biologia, a idéia é que quanto mais interdisciplinar for o grupo mais interessante poderá ser o projeto. Não é preciso que um time seja de uma única universidade ou que uma instituição tenha apenas um time, basta apenas ter uma idéia, um projeto, e instrutores e orientadores para apoiá-lo. E como nem só de flores vive o mais ambicioso projeto, é preciso patrocínio. É comum o patrocínio ser público, uma vez que as equipes representam universidades, mas existem muitos investimentos de empresas interessadas na pesquisa.

Para a inscrição, é cobrada uma taxa de dois mil dólares mais cerca de $225USD por estudante para o atendimento nas competições regionais (uma modificação deste ano na competição) além de mais $425USD para outros participantes. Os mesmos valores são requisitados na fase mundial da competição.

O Evento no MIT.

O evento no MIT.

Escolas de nível médio (equivalentes às high schools americanas) também podem participar. A partir deste ano foi criada uma divisão para essa categoria, que tem participado desde 2008 no iGEM.

O Trabalho

Após a formação de um time, são dados aos estudantes inscritos um kit de partes biológicas do registro de partes biológicas padrão (ver último post) em meados de abril . Eles devem usar essas partes e novas partes com design próprio para construir sistemas biológicos que operam em células vivas, como os que já mostramos aqui a nivel básico em posts antigos (ver Osciladores, e Uma Bactéria que Conta).

Da data de entrega do kit até o fim de setembro, época em que a wiki (exemplo: Bactoblood, da Universidade de Berkley ) que cada time deve fazer é congelada, o time precisa enviar a descrição de seu projeto, propostas de segurança, que precisam ser aprovadas, documentar a parte padrão e registrar o BioBrick no registro de partes padrão. Então em outubro começa a fase regional, uma outra modificação da competição na edição deste ano, para depois haver então  o campeonato global no MIT.

A Competição

Em novembro ocorre o evento que dura cerca de dois dias na sede do MIT. Houve certa discussão nas modificações que ocorreram da edição deste ano para mudar o local do evento para as ilhas Bahamas (!), contudo foi decidido por manter a competição em solo americano devido a possíveis problemas logísticos e de vistos (para que não sabe as ilhas Bahamas é um país!). Nas Bahamas ou não, em toda competição do iGEM, como o próprio site oficial sobre o evento faz questão de ressaltar, os estudantes além de passar por uma experiência cultural, acadêmica e profissional incrível, têm a oportunidade de se divertir um bocado (Veja um dos vídeos do iGEM de 2007).

As competições do iGEM, diferentemente das competições habituais, não têm um foco principal competitivo, mas meritocrático: os times não são à priori julgados comparativamente, mas têm seus prêmios ganhos através do comprimento de requisitos básicos que fazem o grupo merecedor de uma medalha. Os critérios de julgamento para conceder os tipos de medalhas aos grupos orbitam principalmente em torno do BioBrick e à medida em que se conquista uma medalha melhor, as exigências do BioBrick tornam-se maiores. Em resumo os pré-requisitos são:

Medalha de Bronze: Além de realizar a inscrição, ir ao evento e apresentar um pôster, é preciso detalhar no mínino um novo BioBrick padrão no registro de partes  cumprindo todas as normas estabelecidas.

O BioBrick Trophy.

o BioBrick Trophy.

Medalha de Prata: Demonstrar que o BioBrick funciona como esperado e caracterizar (i.e. explicar como funciona) a operação dele in vivo.

Medalha de Ouro: Caracterizar um BioBrick já existente ou melhorá-lo e colocá-lo de volta no registro de partes, e também desenvolver um documento com uma nova técnica padrão que ajude no design, ou caracterização, ou construção, ou análise, ou modelagem, ou simulação, ou compartilhamento (ufa!) de um BioBrick ou do dispositivo biológico envolvido. Além de tudo isso, outro requisito é a cooperação: ajudar outro time do iGEM; como por exemplo na caracterização de um BioBrick e na modelagem ou simulação do sistema da outra equipe competidora (companheira!?) é um grande contribuinte para o prêmio dourado.

Mas como toda boa competição, além das medalhas há uma avaliação do best of the bests dentre as categorias de projeto, podendo dar o título de Area Prize ao time com maior destaque em sua área. As áreas de premiação são:

  • Melhor projeto de Alimentação ou Energia (Best Food or Energy Project).
  • Melhor projeto Ambiental (Best Environment Project).
  • Melhor projeto de Saúde ou Medicina (Best Health or Medicine Project).
  • Melhor projeto Industrial (Best  Manufacturing Project).
  • Melhor nova Área de Aplicação (Best New Application Area).
  • Melhor Avanço Fundamental (Best Foundational Advance).
  • Melhor projeto de Processamento de Informação (Best Information Processing Project).

Há também prêmios especiais para destaques de projetos:

  • Melhor novo BioBrick Natural (Best New BioBrick Part, Natural).
  • Melhor novo BioBrick ou Dispositivo Artificial (Best New BioBrick Part or Device, Engineered).
  • Melhor avanço em Práticas Humanas (Best Human Pratices Advance).
  • Melhor Medida Experimental (Best Experimental Measurement).
  • Melhor Modelo (Best Model).
  • Melhor Wiki (Best Wiki).
  • Melhor Poster (Best Poster).
  • Melhor Apresentação (Best Presentation).

Os maiores prêmios, baseados no desempenho geral na competição, são os troféus de primeiro lugar (imagem acima) e primeiro de vice-campeão e segundo vice-campeão. Além disso, existe também um prêmio especial para a área de desenvolvimento de ferramentas de softwares, cujas medalhas são “coloquialmente chamadas de mousepads” como o site oficial jocosamente menciona.

Após o evento, os participantes são fortemente encorajados a escrever um artigo e publicá-lo em revistas como o Journal of Biological Engineering, e a ir a conferências como a conferência anual do Institute of Engineering and Technology.

Continue lendo…

iGEM: International Genetically Engineered Machine competition

 

Olá pessoal,

Sou a Marianna, este é meu terceiro ano da graduação em Ciências Biológicas pela USP – Universidade de São Paulo. Também sou aluna de iniciação científica na área de microbiologia aplicada e biotecnologia, no Instituto de Ciências Biomédicas (ICB) da USP.

Gostaria de comentar um pouco sobre um evento de Biologia Sintética que acontece anualmente e que é amplamente reconhecido pela comunidade científica: o iGEM.

Os participantes são alunos de graduação, que, orientados por alunos mais experientes, encaram o desafio de compreender, projetar e implementar novos sistemas biológicos sintéticos utilizando partes-padrão de DNA e operá-los em células vivas, com o objetivo de solucionar problemas no mundo (e.g. alimentação, energia, meio ambiente, medicina, processamento de informações), tendo como base princípios de engenharia. O Jamboree, no qual as equipes apresentam seus projetos e resultados, é o maior evento de synbio no mundo, onde os estudantes são premiados com troféus e medalhas em várias categorias. O iGEM teve início em Janeiro de 2003, e em 2004 tinha 5 equipes. Este número vem crescendo, com 130 equipes em 2010. Os estudantes recebem um kit com as melhores partes genéticas disponíveis no início de cada competição e, posteriormente as partes que eles construíram vão para a “coleção de partes”, onde no futuro outros estudantes podem fazer novas construções.

Exemplos de projetos de sucesso incluem:

-Codificação e armazenamento de dados em E. coli (bio-criptografia) (http://2010.igem.org/Team:Hong_Kong-CUHK)

-Resolução do quebra-cabeças Sudoku por E. coli (processamento de informações) (http://2010.igem.org/Team:UT-Tokyo)

-Controle da ordem e sequência de reações em uma via biossintética em particular, de forma a aumentar a velocidade e eficiência da reação (http://2010.igem.org/Team:Slovenia/PROJECT/introduction)

-Descontaminação de áreas com metais pesados (http://2010.igem.org/Team:Peking)

-Sensor de fertilidade do solo, de forma a mapear áreas com concentração de nutrientes, reduzindo malefícios ao meio ambiente e gastos de agricultores (http://2010.igem.org/Team:BCCS-Bristol)

– E. coli produtora de diferentes pigmentos em resposta a diferentes concentrações de um indutor (http://2009.igem.org/Team:Cambridge)

-Construção de promotores sintéticos para permitir monitoramento de várias vias na célula (http://2009.igem.org/Team:Heidelberg)

– Desenvolvimento de uma vacina sintética composta de imunobricks, que estimulam formação de anticorpos (http://2008.igem.org/Team:Slovenia)

Desta forma, é possível perceber que mesmo alunos de graduação, utilizando técnicas aparentemente simples de biologia sintética, podem produzir resultados incríveis e extremamente aplicáveis.

BioBricks: fabricação de uma parte padrão.

Até agora comentamos sobre a possibilidade de juntar diferentes componentes utilizando o padrão técnico de montagem dos BioBricks. Mas neste post vou comentar sobre a fabricação de uma parte padrão. No futuro, eu pretendo comentar sobre a síntese de DNA sintético, mas agora vou explicar como montar um BioBrick utilizando o método de PCR. O aparelho para realizar um PCR, o termociclador, está presente na maioria dos laboratórios de biologia molecular, e hoje se apresenta como uma ferramenta básica para este tipo de atividade. Existem centenas de livros e sites na Internet que podem te familiarizar com a técnica. Primeiramente, um BioBrick pode ser construído via PCR se existe algum molde de DNA do qual o BioBrick possa ser amplificado (por ex., um gene de alguma bactéria) ou se a parte é pequena o suficiente que possa ser criada através do alinhamento e extensão do primer (iniciador). Nos dois casos é necessário adicionar na extremidade 5′ dos primers as sequências referentes aos sítios das enzimas de restrição presentes nos BioBricks, os sufixos e prefixos (ver post anterior).

A construção de BioBricks contendo sequências codificadoras de proteínas requer um sufixo e um prefixo um pouco mais especializados por duas razões:

1. o prefixo é alterado para garantir o espaçamento entre o sítio de ligação do ribossomo e o códon ATG de início.

2. BioBricks que codificam proteínas possuem, por padronização, dois códons de sequência TAA de parada.

Ao construir os primers, basicamente, é necessário “copiar e colar” a seguinte sequência de 31 bp no fim 5′ no seu primer upstream (ou iniciador universal) desenhado para o seu fragmento de DNA de interesse:

5′ —> 3′
GTT TCT TCG AAT TCG CGG CCG CTT CTA G ATG…
start codon (no caso de um gene)
E “copiar e colar” os seguintes 35 bp no fim 5′ do seu primer downstream (iniciador reverso):

5′ —> 3′
GTT TCT TCC TGC AGC GGC CGC TAC TAG TA TTA TAA….
duplo stop codon!

A estas sequências deve-se somar aproximadamente 20 bp de sequência de primer relativa a região codificadora. Para este tipo de clonagem se utiliza uma Taq polimerase com alta fidelidade e um kit de clonagem TOPO-TA cloning.

Claro que todas as outras precauções para se desenhar um primer ainda são válidas, como a verificação de sítios de restrição nas sequências. Para mais detalhes, veja o protocolo disponibilizado para a fabricação de BioBricks.

Sobre ScienceBlogs Brasil | Anuncie com ScienceBlogs Brasil | Política de Privacidade | Termos e Condições | Contato


ScienceBlogs por Seed Media Group. Group. ©2006-2011 Seed Media Group LLC. Todos direitos garantidos.


Páginas da Seed Media Group Seed Media Group | ScienceBlogs | SEEDMAGAZINE.COM