Enquete: Qual projeto você acha mais interessante!?

Chegamos ao fim do ano com três projetos bastante interessantes para levarmos ao iGEM e queríamos a opinião de vocês sobre qual deles vocês acham mais legal e o porquê! Deêm uma conferida num resumo super rápido de cada proposta:

Plasmídeo Plug&Play

Cansado de ter que fazer v√°rios passos metodol√≥gicos para transformar microrganismos? Voc√™ adoraria expressar um gene que voc√™ sempre quis em sua bact√©ria de um jeito f√°cil, r√°pido, barato e acess√≠vel? Chegou a solu√ß√£o! Com apenas dois pequenos passos voc√™ tem em m√£os um kit de transforma√ß√£o “fa√ßa-voc√™-mesmo” (DIY), sem precisar de equipamentos e reagentes caros! Basta fazer um PCR e depois a transforma√ß√£o! Esque√ßa outros passos como digest√£o, liga√ß√£o, e v√°rios outros PCRs cansativos! Veja aqui o link de um v√≠deo sobre a proposta.

Rede de Memória Associativa em Bactérias

Imagine se fosse poss√≠vel reproduzir um comportamento cerebral… sem o c√©rebro! Esse √© um tipo de desafio que muitos cientistas da computa√ß√£o e programadores andam trabalhando por a√≠. Na Biologia Sint√©tica tamb√©m! Inspirado em algumas publica√ß√Ķes recentes envolvendo experimentos in vitro¬†de sistemas com comportamento de uma rede neural, queremos criar um modelo in vivo¬†disso, e sem usar neur√īnios: com popula√ß√Ķes de bact√©rias! Elas seriam capazes de reconhecer um padr√£o luminoso incompleto de uma “mem√≥ria” que possuem e depois completar esse padr√£o, dando uma sa√≠da (output) luminosa com o padr√£o mais pr√≥ximo de sua mem√≥ria em rela√ß√£o ao padr√£o inicial dado. J√° escrevemos um post sobre o caminho de liga√ß√Ķes improv√°veis que fizemos para chegar na ideia desse projeto. Veja aqui o link de um v√≠deo sobre a proposta.

Sensor de Tens√£o Mec√Ęnica de Membrana

N√≥s temos mecanismos sensoriais bem parecidos dos que existem em microrganismos. Basicamente eles podem ser: metab√≥litos, temperatura, luz, voltagem, e at√© mesmo campos magn√©ticos. Mas e o “tato”!? Aquele tipo de sensor que usamos a todo momento! Como fazer microrganismos traduzirem um contato f√≠sico em uma resposta (igual por exemplo √† essa plantinha aqui)!? √Č o que prop√Ķe a ideia desse projeto. Propor um novo sensor que pretende fazer microrganismos nos contarem que os estamos tocando (atrav√©s desse Biobrick, um “stretch channel”), emitindo luz azul nesse processo (atrav√©s desse Biobrick, Aequorina). No final, podemos aplicar isso igual ao esquema da figura a√≠ em cima. Veja o link de um v√≠deo sobre a proposta aqui¬†(< desatualizado, mas no m√≠nimo d√° pra entender de onde veio o insight da ideia).

E aí!? O que você acha? Dê o seu pitaco!

Liga√ß√Ķes Improv√°veis: RNA antisense, Sudoku e Redes Neurais

A ci√™ncia √© cheia de liga√ß√Ķes improv√°veis.

Veja por exemplo o estudo das part√≠culas subat√īmicas e seus spins: quem diria que conhecer isso poderia permitir uma revolu√ß√£o na neuroci√™ncia? Entendendo como o n√ļcleo at√īmico dos √°tomos se comporta em um campo magn√©tico foi poss√≠vel construir o aparelho que permite literalmente olhar dentro de nosso c√©rebro, passando bem longe de um desconfort√°vel bisturi: o aparelho de Resson√Ęncia Magn√©tica Nuclear Funcional (geralmente os hospitais e cl√≠nicas tiram o “Nuclear” do nome porque isso assusta os pacientes; √© s√©rio!).

Chamamos essas liga√ß√Ķes de “improv√°veis” principalmente por causa da sua contra-intuitividade, afinal quem pensaria em analisar o comportamento de c√©rebros ao se estudar algumas das menores coisas do universo!? Fazer essas pontes √© o que se precisa para criar inova√ß√£o, e √© exatamente na busca desse tipo de coisa que nas √ļltimas reuni√Ķes do Clube de Biologia Sint√©tica come√ßamos a fazer algumas liga√ß√Ķes (n√£o necessariamente na ordem do t√≠tulo) que “do lado de fora” t√™m uma apar√™ncia improv√°vel, mas que no fundo talvez s√≥ sejam contra-intuitivas.

Tudo começou, ou melhor, tudo deveria ter começado (para amenizar a aparente desconexão) falando-se da mais novinha regulação de expressão gênica no mundo das descobertas científicas:

O RNA de Interferência

Representação do funcionamento dos RNAs antisense: quando se ligam à uma fita de RNA mensageiro com alto grau de complementariedade entre as fitas (diz-se "complementariedade" entre duas fitas de DNA (ou RNA) quando o código genético de ambas têm sequências de nucleotídeos que ligam-se entre si através dos pares A-T (U em RNAs) e C-G formados entre as fitas), há o bloqueiro da atuação da RNA polimerase, impedindo a tradução do RNA em proteína. Se não houver muita correspondência entre as fitas de RNA a traduação continua normalmente.

√Č mais uma daquelas descobertas “nob√©licas”, estudada pelos pesquisadores americanos Andrew Fire e Craig Mello em 1998, ganhando o pr√™mio em 2006. A grande ideia dos RNAs de interfer√™ncia (iRNA) √© o pareamento¬† de pequenos segmentos de RNA – que n√£o s√£o codificados em prote√≠nas – com RNAs mensageiros, impedindo que sejam traduzidos por “bloquear” o ribossomo . Esse sistema de inibi√ß√£o g√™nica envolve v√°rias enzimas (se quiser saber mais veja esse √≥timo v√≠deo)¬†e √© um pouco mais complexo do que o sistema de regula√ß√£o g√™nica daquilo que chamamos de RNA antisense, mas na ess√™ncia funcionam do mesmo jeito: bloqueio da tradu√ß√£o atrav√©s de um RNA antisense complementar.¬†A grande diferen√ßa entre os RNAs antisense e os de interfer√™ncia, que s√£o comumente confundindos com sin√īnimos, √© que os iRNA atuam atrav√©s de toda uma via de rea√ß√Ķes enzim√°ticas em eucariotos, enquanto os RNA antisense s√£o mais caracter√≠sticos de seres procari√≥ticos e n√£o precisam de uma via enzim√°tica para regularem a express√£o g√™nica.

Diferentemente dos outros tipos de regula√ß√£o mediados por inibidores, que s√£o basicamente prote√≠nas que se ligam ao DNA inibindo a transcri√ß√£o g√™nica, com os RNAs antisense t√™m-se uma gama muito maior de inibidores da express√£o g√™nica. Imagine que voc√™ quer controlar uns 2 ou 3 genes em uma bact√©ria: existem muitos metab√≥litos que podem fazer esse trabalho (por exemplo IPTG, galactose, TetR e etc.), mas e se voc√™ quiser ter um controle de mais genes, digamos, uns 20!? D√°-lhe repressores! Por outro lado, se for poss√≠vel usar RNAs de interfer√™ncia suficientemente eficientes, poderia se fazer um vetor de transforma√ß√£o¬†bem mais enxuto (em rela√ß√£o aos s√≠tios repressores) al√©m de poder construir um mecanismo de repress√£o mais orientado ao “alvo” de repress√£o: basta construir um RNA mensageiro complementar. √Č exatamente essa versatilidade que torna poss√≠vel contruir uma…

 Bactéria Resolvedora de Sudoku

Legal: Sudoku, Bact√©rias e RNA antisense… O que essas coisas t√™m a ver!?

Essa grande ideia veio do time japon√™s UT-Tokyo do iGEM de 2010, e al√©m de usar RNAs antisense, tamb√©m usou do dispositivo g√™nico baseado em recombinases¬†semelhante ao que o time da Unicamp usou em 2009¬†para a mesma finalidade, que √© diferenciar diferentes popula√ß√Ķes de bact√©rias. O sistema que eles criaram funciona basicamente assim:

Popula√ß√Ķes Diferentes

Diferentes tipos de Popula√ß√Ķes

Eles representaram (em um sudoku 4×4) cada posi√ß√£o por uma popula√ß√£o espec√≠fica de E.coli’s. Cada posi√ß√£o tem algo em seu DNA que a torna diferente de todas.

Diferentes Estados

Estados das Popula√ß√Ķes

Cada popula√ß√£o pode se diferenciar em quatro tipos diferentes de E.coli’s correspondentes √† cada n√ļmero que um sudoku 4×4 permite (1, 2, 3 e 4).

Comunica√ß√£o entre as Posi√ß√Ķes (Popula√ß√Ķes)

Comunica√ß√£o viral entre as posi√ß√Ķes (popula√ß√Ķes) do sudoku

As popula√ß√Ķes devem se comunicar para transmitir a informa√ß√£o de suas posi√ß√Ķes para as outras posi√ß√Ķes; afinal √© assim que se resolve um sudoku: podemos dizer que uma posi√ß√£o √© 1, 2, 3 ou 4 depois de recebermos as informa√ß√Ķes de quais n√ļmeros existem no quadrado, linha e coluna correspondente √† posi√ß√£o em quest√£o.

Essa comunica√ß√£o √© feita atrav√©s de vetores virais, que s√£o v√≠rus que as bact√©rias produzem para infectar as outras popula√ß√Ķes correspondentes √†s outras posi√ß√Ķes, transmitindo as informa√ß√Ķes que possuem (como sua “posi√ß√£o” e “estado”: 1, 2, 3 ou 4).

Diferenciação dos Estados

Diferenciação dos estados

Para o sudoku funcionar, quando uma posi√ß√£o identificar qual √© o estado de suas vizinhas, ela deve se diferenciar justamente no estado que n√£o recebeu sinal. Por exemplo (imagem ao lado), se a posi√ß√£o (1,1) (linha 1, coluna 1)¬†receber as informa√ß√Ķes de que certas posi√ß√Ķes em seu quadrado, linha e coluna j√° est√£o diferenciadas nos estados 3, 2 e 1, ela deve se diferenciar em 4. Para conseguir fazer isso, os japoneses usaram o dispositivo chamado “4C3 leak switch”, que se baseia na probabilidade de uma polimerase em “ignorar” os s√≠tios terminadores de transcri√ß√£o. Para entender melhor, veja a imagem abaixo:

Cada gene codifica um tipo de¬†recombinase¬†(as setinhas apontando para a esquerda: Hin, flpe, Ligand 3 e Ligand 4). Quando a E.coli for infectada por um v√≠rus de uma posi√ß√£o com que se comunica, ele inserir√° um plasm√≠deo que expressa uma dessas 4 recombinases, agindo nas posi√ß√Ķes que flanqueam o mesmo gene na bact√©ria. Por exemplo, na imagem da diferencia√ß√£o dos estados,¬†a posi√ß√£o (2,2) envia um v√≠rus √† (1,1) passando a informa√ß√£o de que possui o estado “2”, expressando a recombinase flpe e retirando o respectivo gene do plasm√≠deo bacteriano atrav√©s das posi√ß√Ķes FTR que flanqueiam o gene (ver imagem acima). Ao fazer isso, tamb√©m retirar√° o s√≠tio terminador que fica entra os FTR, aumentando a probabilidade da polimerase atravessar todas as sequ√™ncias de recombinases de sequ√™ncias invertidas e expressar a cre recombinase (setinha cinza apontando para a direita). Depois, se a posi√ß√£o (1,1) receber mais dois v√≠rus diferentes, ele perder√° 3 genes de recombinase e tr√™s s√≠tios terminadores, restando apenas um s√≠tio terminador entre o promotor pT7 e o gene cre. Nesse est√°gio, a probablilidade de a polimerase ultrapassar o s√≠tio terminador (da√≠ que vem o “leak”) √© consider√°vel, e quando o faz, transcreve a cre recombinase, que retira seu pr√≥prio gene e os dois s√≠tios terminadores duplos depois dele, conectando o gene de recombinase que n√£o foi retirado do plasm√≠deo junto dos genes que tamb√©m est√£o em sentido reverso, transcritos pelo promotor pSP6. Al√©m disso promove a produ√ß√£o de v√≠rus atrav√©s da retirada dos dois s√≠tios de parada que separam o segundo promotor pT7¬† do gene que transcreve a polimerase que atua no promotor pSP6 e o gene que produz o caps√≠deo do v√≠rus. O empacotamento das sequ√™ncias gen√©ticas no v√≠rus acontecem ap√≥s a loading sequence (ret√Ęngulo rosa). Isso faz com que a posi√ß√£o 1 passe tamb√©m a “emitir” v√≠rus informando seu estado e posi√ß√£o.

Para entender de verdade, vale assistir o vídeo (começa mesmo aos 24 seg) que o próprio time japonês fez para mostrar o funcionamento do sistema (percebam o sotaque!):

Restri√ß√£o de Posi√ß√Ķes

Para isso dar certo √© preciso que somente as popula√ß√Ķes da respectiva linha, coluna e quadrado comuniquem-se entre si, ou seja, deve have uma restri√ß√£o √† comunica√ß√£o entre as popula√ß√Ķes de posi√ß√Ķes n√£o-relacionadas segundo o sudoku. Como isso √© feito!? Sim! RNAs antisense!

Tudo isso s√≥ consegue funcionar gra√ßas √† atua√ß√£o dos RNAs antisense que coordenam o fluxo de informa√ß√£o entre as diferentes popula√ß√Ķes associadas √†s diferentes posi√ß√Ķes do sudoku. Na imagem do 4C3 leak switch s√£o as location sequence que cont√©m todas as sequ√™ncias codificantes dos RNAs de interfer√™ncia de cada posi√ß√£o. Com isso √© poss√≠vel construir uma tabela de correspond√™ncia de antisense que dir√° quais antisense uma posi√ß√£o deve fazer para inibir a atua√ß√£o dos v√≠rus de outras posi√ß√Ķes n√£o-relacionadas:

Mas espera a√≠! O sudoku √© uma tabela 2D, como √© poss√≠vel separar as diferentes popula√ß√Ķes, uma em cada posi√ß√£o caracter√≠stica, e assim fazer a transfer√™ncia de informa√ß√£o!? √Č preciso construir algo f√≠sico – uma tabela de sudoku de verdade – para esse sistema sint√©tico!? Resposta: n√£o √© preciso “separar” as popula√ß√Ķes, a intera√ß√£o entre os RNAs antisense dos v√≠rus de cada popula√ß√£o que remete √† uma posi√ß√£o d√° conta do recado. Voc√™ pode misturar todas a popula√ß√Ķes em um tubo de ensaio (com o input, √© claro) e depois analisar os estados de cada bact√©ria pertencente √† um tipo de popula√ß√£o (por sequenciamento) e assim saber o resultado do sudoku.

Esse conceito de restri√ß√£o de informa√ß√£o por RNAs antisense, e esse fluxo de informa√ß√£o por v√≠rus √© essencial para se entender o que est√°vamos discutindo no clube de biologia sint√©tica, sobre como fazer em um sistema bact√©riano uma…

Rede Neural

Por fim: rede neural! Como fazer um dispositivo biológico sintético que imite uma rede neural!?

Bem, abstratamente falando, uma rede neural pode ser simbolizada atrav√©s da imagem ao lado: os neur√īnios (as bolinhas) e suas liga√ß√Ķes. O que temos em comum entre esses sistema e o sudoku s√£o que temos posi√ß√Ķes espaciais trocando informa√ß√Ķes e seguindo um padr√£o. No sudoku o que restringe o fluxo de informa√ß√£o s√£o as regras que pr√©-estabelecemos para o jogo, no sistema neuronal o que restringe a comunica√ß√£o √© apenas o espa√ßo (existe um n√ļmero finito de liga√ß√Ķes ax√īnicas que os neur√īnios podem fazer devido √† limita√ß√£o de espa√ßo), al√©m de outro fator: o “peso” dessas intera√ß√Ķes, que associa uma intensidade de fluxo de informa√ß√£o entre neur√īnios (o aumento desses “pesos” durante o tempo devido a um est√≠mulo √© o que chamamos de aprendizado).

Rede de Hopfield

Para querer fazer o design de um sistema sintético que se comporte como uma rede
neural devemos usar um modelo que represente uma rede neural! Existem v√°rios deles, mas um mais simples e talvez o mais interessante para usarmos √© a Rede de Hopfield,¬†muito usada em computadores para reconhecimento de padr√Ķes. Hopfield √© chama de uma rede de mem√≥ria associativa¬†pois consegue armazemar mem√≥ria atrav√©s da associa√ß√£o de informa√ß√Ķes existentes na comunica√ß√£o entre v√°rios neur√īnios. Uma das implica√ß√Ķes disso √© a capacidade de recuperar esse padr√£o mesmo quando dado um padr√£o incompleto.

Exemplo do Funcionamento

Imaginemos que, semelhantemente ao sudoku, tamb√©m tenhamos uma matriz com posi√ß√Ķes, s√≥ que agora 3×3 e tendo apenas dois estados: “preenchida” ou “ativada”(denotada por 1), e “n√£o-preenchida” ou “inativada” (denotada por 0). Podemos construir ent√£o “letras” preenchendo essas posi√ß√Ķes. Queremos que nosso sistema reconhe√ßa o padr√£o incompleto dessas letras e complete-o com sua mem√≥ria:

Legal, mas como funciona o algoritmo¬†disso!? Basicamente √© com a defini√ß√£o das conex√Ķes que esses dois padr√Ķes t√™m. Partindo da hip√≥tese que somente as posi√ß√Ķes pr√≥ximas podem se comunicar (assim como neur√īnios, em um modelo simplificado), no padr√£o que pr√©-estabelecemos para o sistema, a comunica√ß√£o entre duas posi√ß√Ķes preenchidas √© considerada excitat√≥ria, ou seja, uma posi√ß√£o influencia a outra a permanecer ativada; j√° quando uma posi√ß√£o n√£o-preenchida se comunica com uma preenchida, a comunica√ß√£o √© considerada inibit√≥ria; e por fim, quando duas posi√ß√Ķes n√£o-preenchidas est√£o uma ao lado da outra, h√° indiferen√ßa e n√£o h√° ativa√ß√£o ou inibi√ß√£o entre si (ver imagem abaixo). Com isso podemos criar uma rede de comunica√ß√£o¬† caracter√≠stica de cada figura com os pesos dos padr√Ķes.

Para a rede reconhecer ambos os padr√Ķes, deve-se somar os pesos dos padr√Ķes L e T:

Cada peso de comunica√ß√£o da soma dos pesos √© computada para reestabelecer um dos padr√Ķes da mem√≥ria dado um padr√£o incompleto. Vejamos o exemplo da imagem abaixo: um L incompleto. Para decidir se a posi√ß√£o n√£o-preenchida se preencher√° √© preciso computar o padr√£o incial em rela√ß√£o aos pesos na “mem√≥ria da rede” com a express√£o abaixo, em que wik √© o peso da intera√ß√£o entre a posi√ß√£o em quest√£o (denotada por i) e uma determinada posi√ß√£o k.

Ent√£o somando-se os produtos entre os estados xk (das k posi√ß√Ķes comunicando-se com a posi√ß√£o incompleta) e os pesos wik das intera√ß√Ķes entre as k posi√ß√Ķes e a posi√ß√£o incompleta, define-se o estado que a posi√ß√£o incompleta deve ter: se √© de fato um estado inativado ou ativado (preenchido):

x(3,1) = 1 . 1 + 0 . 1

x(3,1) = 1

Portanto, segundo a intera√ß√£o associativa da rede, a posi√ß√£o (3,1) torna-se em um estado ativado (1) completando a letra L. Para diferentes inputs o c√°lculo √© o mesmo e (com algumas exce√ß√Ķes) o sistema sempre se ajusta √† um dos dois padr√Ķes de sua mem√≥ria: ou um L ou um T.

Como Fazer isso com Bactérias

Assim comom no sudoku, podemos criar diferentes popula√ß√Ķes de bact√©rias para cada posi√ß√£o al√©m de – pelo mesmo mecanismo – uma rede de transmiss√£o de RNAs antisense por v√≠rus baseando-se na tabela de pesos das intera√ß√Ķes entre as popula√ß√Ķes existentes (a “mem√≥ria” do sistema), de modo que cada posi√ß√£o tenha os antisense corretos para reprimir ou estimular a produ√ß√£o de uma determinada prote√≠na rep√≥rter para cada posi√ß√£o! O que se diferenciaria do sudoku √© que precisar√≠amos construir um aparelho literal do sistema que queremos construir, ou seja: √© preciso separar as diferentes popula√ß√Ķes para discernir os outputs para saber ao certo qual popula√ß√£o referente emitiu luz verde por GFP,¬†por exemplo. O input tamb√©m poderia ser luz, feito atrav√©s de um light switch.

E assim o ciclo das rela√ß√Ķes um tanto improv√°veis se fecha. Mas como a ci√™ncia √© extremamente mut√°vel v√°rios outros assuntos podem se juntar nessa ciranda e dar origem a outras “improbabilidades”. Voc√™, leitor, tamb√©m pode fazer parte desse trabalho ou pelo menos acompanhar de perto e conhecer um pouco melhor sobre essas coisas que andam rolando nas discuss√Ķes do clube de biologia sint√©tica atrav√©s das reuni√Ķes gravadas, em especial (sobre como fazer uma rede neural artificial em bact√©rias)¬† essa aqui no nosso canal no LiveStream.

Quem sabe possamos colocar em pr√°tica tudo isso!? Vejamos em 2012!

Brasil no iGEM

Para quem acha, n√£o somos o primeiro grupo a ambicionar ir a um evento do iGEM. L√° pelos idos de 2009 o Brasil participou pela primeira vez da competi√ß√£o representado pela Unicamp, conseguindo trazer aqui para o lado de baixo do hemisf√©rio uma medalha de ouro j√° “de cara”, equiparando-se √†s universidades mais renomadas do mundo, como Cambridge, Harvard e outras.

Sob o projeto intitulado “Microguards”, o time brasileiro criou um mecanismo de transforma√ß√£o de E.Coli’s e de leveduras¬† (S. Cerevisiae) em “micro guardas”, que atacam bact√©rias contaminantes de biorreatores de etanol, no caso as bact√©rias do g√™nero Lactobacillus (do tipo daquelas que regulam a sua a√ß√£o intestinal quando voc√™ bebe o seu leite fermentado – Yakult, Chamyto, e etc -). Usar um mecanismo como esse na ind√ļstria brasileira evitaria o atual desperd√≠cio de milhares de litros de √°lcool que deixam de ser produzidos por causa do a√ß√ļcar consumido pelos microorganismos invasores nos bioreatores de etanol. Cerca de 5 √† 10 % da produ√ß√£o √© desperdi√ßada por causa desses ladr√Ķezinhos.

O Mecanismo

Reconhecimento

“ColiGuards”

Criando uma esp√©cie de “sistema imune de bioreatores”, duas linhagens de E.coli’s s√£o criadas no meio de cultivo: a linhagem natural chamada de workers linage e a linhagem de “microguards”, ou killers linage; a popula√ß√£o dos dois tipos de linhagem varia dependendo do grau de contamina√ß√£o do meio, ou seja, quando n√£o h√° contaminantes, muito poucas bact√©rias workers transformam-se em killers e vice-versa.

A transforma√ß√£o em killers √© ativada por, um metab√≥lito secund√°rio de quorum sensing, AI-2 (se quiser saber mais clique aqui),¬† que √© liberado tanto pela bact√©ria contaminante quanto pelas E.Coli’s selvagens, √© reconhecido pelas E.Coli workers, que n√£o produzem AI-2, o que as induz a diferenciarem-se em killers. Al√©m disso elas podem detectar os contaminates atrav√©s da conjuga√ß√£o bacteriana¬†com os microorganismos invasores, abilidade que s√≥ as killers passam a ter no processo de diferencia√ß√£o, utilizando-a apenas naqueles microorganismos que possuem um plasm√≠deo diferente do seu (veja “recognition by conjugation” aqui).

“YeastGuards”

Para as Leveduras o mecanismo de reconhecimento da presen√ßa de contaminantes √© um pouco mais simples: a produ√ß√£o de lactato provinda do consumo de a√ß√ļcar dos Lactobacillus √© utilizada para ativar gatilhos g√™nicos – o que somente √© poss√≠vel atrav√©s da sensibiliza√ß√£o das leveduras ao lactato, utilizando uma permease expressa pela levedura para facilitar sua incorpora√ß√£o √† c√©lula – que induzem um ataque aos contaminantes.

Diferenciação

Os brasileiros aproveitaram o elegante design feito pelo time franc√™s da universidade de Paris no iGEM de 2007 para cria√ß√£o de um sistema de diferencia√ß√£o das E.Coli’s em microguards. Com a atua√ß√£o de uma recombinase (a cre recombinase),¬† parte dos genes do plasm√≠deo que transforma o microorganismo sofre excis√£o, tornando-se um pequeno peda√ßo de DNA circular com baixa taxa de atividade e sem origem de replica√ß√£o, enquanto os outros genes que permaneceram no plasm√≠deo passam a se tornar ativos devido ao seu reposicionamento na fita de DNA logo ap√≥s um promotor, como pode ser visto na imagem logo abaixo:

Lox71 e lox66 s√£o os s√≠tios do DNA onde atuam as cre recombinases (atua√ß√£o simbolizada pelo raio vermelho). Ap√≥s sua a√ß√£o, os genes ap√≥s as regi√Ķes de termina√ß√£o (T) s√£o reposicionados - no caso do exemplo o gene dapA - pr√≥ximos ao promotor que antes era da regi√£o excisionada (na imagem o promotor Tet), e por isso tornam-se ativos.

O controle populacional dos microorganismos killers √© mantido atrav√©s do gene ftsK da imagem acima: um gene que produz uma prote√≠na determinante na divis√£o celular, sendo uma “m√°quina literal de segrega√ß√£o de cromossomos”.¬†Dessa maneira, evita-se que a popula√ß√£o de killers cres√ßa demais e se torne um “tiro pela culatra”, diminuindo a produ√ß√£o de etanol.

Outro aspecto bastante interessante da constru√ß√£o das ColiGuards √© o mecanismo de controle de uma popula√ß√£o basal de killers em um biorreator n√£o contaminado. Eles usaram uma criativa constru√ß√£o feita por outro time do iGEM, o de Caltech de 2008, que se aproveitou de uma “falha” da atividade da DNA-polimerase para randomizar a express√£o de um gene em uma popula√ß√£o bacteriana. Essa “falha” √© a caracter√≠stica que a polimerase possui de ignorar ou repetir algumas sequ√™ncias de nucleot√≠deos que s√£o repetidas longamente no c√≥digo, produzindo uma c√≥pia de DNA com um n√ļmero vari√°vel dessas repeti√ß√Ķes (fen√īmeno chamado de SSM, do ingl√™s: slipped-strand mispairing), a consequ√™ncia disso √© que a sequ√™ncia codificadora (o gene) pode ser deslocada da posi√ß√£o correta em rela√ß√£o ao seu start codon se as repeti√ß√Ķes n√£o forem m√ļltiplas de 3 (porque cada c√≥don √© constitu√≠do de 3 nucleot√≠deos), e assim a tradu√ß√£o n√£o √© feita corretamente. Veja figura abaixo:

As letras mai√ļsculas correspondem cada uma a um amino√°cido, traduzido por um c√≥don (grupo de tr√™s nucleot√≠deos). ATG √© o start codon e TAA √© um codon de parada formado pelo deslocamento da sequ√™ncia codificadora. Repare que ap√≥s uma SSM, uma repeti√ß√£o foi omitida.

Assim, as replica√ß√Ķes de DNA que tiverem as repeti√ß√Ķes m√ļltiplas ATGC m√ļltiplas de tr√™s, ter√£o o ajuste correto da regi√£o codificadora em rela√ß√£o ao start c√≥don e a tradu√ß√£o correta da cre recombinase ser√° poss√≠vel:

Alguns tipos de Slipped Strand Mutation que podem acontecer na população de E.Coli's.

Como esse tipo de erro da DNA-polimerase n√£o √© t√£o frequente, apenas uma pequena parte da popula√ß√£o se diferenciar√° em killer se as repeti√ß√Ķes forem colocadas antes do gene da cre recombinase.

Para diferenciar bactérias workers na vizinhança de contaminantes, todos os microguards possuem uma outra cópia do gene recombinase, mas controlado por um promotor sensível ao AI2 liberado pelos Lactobacillus e pelas Coliguards quando detectam a presença dos invasores (figura ao lado).

Mecanismo de Ataque

Os mecanismos de ataque aos contaminantes que os Microguards possuem s√£o divididos em tr√™s tipos: a¬†libera√ß√£o de subst√Ęncias nocivas ao¬† Lactobacillus, a conjuga√ß√£o de um plasm√≠deo contendo genes que provocam a morte celular do invasor, e a estrat√©gia kamikaze: quando se libera uma grande quantidade de subst√Ęncias que s√£o nocivas ao Lactobacillus e levam o microorganismo √† lise (ver figura abaixo). A Yeastguard possui em seu arsenal somente o primeiro mecanismo, enquanto a Coliguard disp√Ķe dos tr√™s no combate aos invasores. Essa desigualdade beligerante entre os dois microorganismos, segundo o pr√≥prio grupo (veja a parte dois do v√≠deo no final do post), n√£o foi uma discrimina√ß√£o proposital √†s Leveduras: se deu mais √† falta de tempo para implantar e documentar a maquinaria funcionando nas Leveduras at√© o congelamento da wiki do grupo. Competi√ß√Ķes t√™m dessas coisas!

A constru√ß√£o desses mecanismos de ataque aproveitou-se da maior diferen√ßa estrutural entre as E.coli’s e¬†Leveduras, e o Lactobacillus:¬† a coli √© uma bact√©ria Gram negativa (possui duas membranas celulares, existindo entre elas uma fina parede celular) e o invasor √© Gram positivo (possui apenas uma parede celular no exterior e uma membrana celular interior do compartimento celular), enquanto a parede celular das leveduras √© constitu√≠da de carbohidratos, diferentemente dos pept√≠deoglicanos¬†do contaminante. Sabendo disso, o grupo resolveu expressar subst√Ęncias que ataquem a parede celular de pept√≠deoglicanos exposta dos¬† Lactobacillus e encontraram as lisozimas como a arma perfeita para isso, sendo usadas tanto na secre√ß√£o como no m√©todo kamikaze.

O grande problema dos m√©todos de secre√ß√£o √© que eles podem se comportar como contaminantes, al√©m da consequente redu√ß√£o do grau de efetividade da enzima durante o tempo devido √† sele√ß√£o natural. A solu√ß√£o encontrada para esse problema foi a conjuga√ß√£o de um plasm√≠deo (lembrando que somente as killers t√™m a abilidade de conjuga√ß√£o!) com o gene de uma endonuclease, a colicina, destruindo os Lactobacillus “por dentro”. Para que as pr√≥prias E.coli’s n√£o fossem afetadas por esse gene letal, foi inserido um gene de resist√™ncia que torna a express√£o de colicina inofensiva √†s Coliguards.

iGEM 2009

Melhor do que descrever como foi o projeto, nada melhor do que as próprias pessoas que participaram do evento para explicarem o que fizeram! Confira a apresentação do grupo brasileiro no Jamboree realizado em 2009 no MIT:

E nesse ano h√° outro time em associa√ß√£o com a universidade francesa de Saint-Etienne, com o projeto intitulado “Stress Wars”. Confira o que j√° est√° sendo feito nesse novo projeto franco-tupiniquim grupo junto aos outros links interessantes logo abaixo:

E a USP? Quando entrará nessa também!?
Aguardemos!

DNA como Código de Barras

DNA barcodeDesde o incr√≠vel advento do¬†sequenciamento¬†g√™nico l√° pelos idos dos anos 70 o volume de dados obtidos das mais variadas combina√ß√Ķes de nucleot√≠deos encontradas na natureza √© estonteante. Fazendo um c√°lculo bem simples com s√≥ cinco nucleot√≠deos, temos 3125 combina√ß√Ķes diferentes das letrinhas A,T,C e G!

√Č l√≥gico que hoje tamb√©m conhecemos uma enorme quantidade de padr√Ķes dessas letrinhas que nos dizem: “Olha, aqui termina um gene!”, ou “√Č aqui que o ribossomo gruda!”, entre outras coisas. O ruim √© que s√≥ √† partir do DNA √© bem mais trabalhoso e dif√≠cil dizer de qual criatura vieram aquelas informa√ß√Ķes encriptadas ali quando comparada √† mera observa√ß√£o daquele ser vivo. E em alguns casos, mesmo que se conhe√ßa de onde vem o DNA, h√° a d√ļvida se ele veio mesmo de onde parece ter vindo: como se poderia ter certeza, por exemplo, se aquela bonita carteira de couro que te deram de presente n√£o veio de uma esp√©cie de jacar√© em extin√ß√£o em vez de um r√©ptil criado em cativeiro!? A grande ideia √© fazer o mesmo que voc√™ faz quando vai ao supermercado: em vez de escanear cada dobra da embalagem, abri-la, fazer uma fina an√°lise do conte√ļdo, al√©m de ter que sair por a√≠ perguntado quanto custa, basta colocar aquela figurinha cheia de barras que existe em algum canto da embalagem num detector e pronto! Voc√™ passa a saber com rapidez do que se trata aquilo. No c√≥digo gen√©tico tenta se fazer a mesma coisa.

A Vida Rotulada

A regi√£o do DNA (l√≥cus) que deve ser usada para ser um “c√≥digo de barras” (CB) tem que ao mesmo tempo ser conservada e vari√°vel, do mesmo modo que os CB’s s√£o todos barrinhas pretas de mesmo tamanho, mas com comprimentos e espa√ßamentos vari√°veis. Essa regi√£o pode variar com os reinos dos seres vivos, mas no caso dos eucariotos, a regi√£o de 648 pares de bases do DNA mitocondrial que codifica a subunidade 1 da enzima citocromo mitocondrial C oxidase, √© hoje amplamente usada como c√≥digo de barras. O DNA mitocondrial √© ideal para ser usado como CB uma vez que sua taxa de muta√ß√£o nos seres vivos durante a evolu√ß√£o √© muito alta, o que resulta em uma varia√ß√£o significativa das sequ√™ncias entre as esp√©cies.

Rotulando uma parte pelo todo √© muito mais f√°cil para os bi√≥logos associarem uma marca √ļnica de cada esp√©cie √†s suas j√° elaboradas classifica√ß√Ķes do zool√≥gico da vida, al√©m de tornar muito mais f√°cil o controle, detec√ß√£o e prote√ß√£o de v√°rias esp√©cies de animais. Exitem grandes bancos de dados com um n√ļmero crescente de DNA Barcodes (c√≥digos de barras de DNA), um dos mais not√≥rios √© o projeto International Barcode of Life¬†(Com site muito bonito ali√°s!) que j√° conta – pelo menos at√© agora pouco quando dei uma olhada – cerca de 1 milh√£o e 330 mil esp√©cies no cat√°logo.

Código de Barras Literal

Aqui √© o ponto em que a biologia sint√©tica, ou pelo menos a engenharia gen√©tica, entra nisso tudo: como rotular os transg√™nicos? Bem, esse √© um probleminha que foi bem discutido nos √ļltimos anos que se passaram, principalmente porque as ind√ļstrias n√£o queriam facilitar que sua tecnologia fosse copiada por outras companhias, enquanto governos e opini√£o p√ļblica queriam uma regulamenta√ß√£o que gerassem medidas que discriminassem um produto transg√™nico de um n√£o-transg√™nico – um pouco por motivos ideol√≥gico-sociais, mas principalmente por motivos ecol√≥gicos: tornando a possibilidade de rastrear os culpados na hip√≥tese de uma contamina√ß√£o em certeza, haveria uma maior press√£o para execu√ß√£o adequada das medidas de seguran√ßa impostas pela lei.

Foi aí então que criaram Рou melhor patentearam Рuma padronização para códigos de barras bem interessante, que além de naturalmente tornar a identificação do transgênico muito mais fácil à partir de uma simples amostra de DNA, mantém a tecnologia em segredo e ainda conta com os mesmos processos utilizados em computador para correção de dados e compactação dos mesmos. Além dessa padronização que iremos explicar adiante, o próprio pessoal do Registro de Partes Padrão desenvolveu um Barcode para os Biobricks, que não é tão sofisticado, mas que corresponde à sua finalidade.

Escrevendo Com Quatro Letras

Para escrever textos com apenas quatro letras é muito simples se você sabe escrever

Imagem modificada retirada de http://tinyurl.com/3g46mnj

letras com n√ļmeros. Os computadores usam uma tabela que traduz o valores num√©ricos (ou melhor, bits) associados √† um caractere do alfabeto alfanum√©rico: a famosa tabela ASCII. Para escrever letras no DNA ent√£o √© muito mais f√°cil que no computador, principalmente porque ele utiliza o sistema bin√°rio de contagem, enquanto no DNA √© poss√≠vel usar o quatern√°rio, com os 4 “n√ļmeros” poss√≠veis: A, T, C e G, valendo 0, 1, 2, e 3 respectivamente (ver figura ao lado).

Com isso foi poss√≠vel criar a seguinte (ver imagem abaixo) constru√ß√£o n√£o-codificante de DNA que conta com informa√ß√Ķes relativas √† por exemplo o nome da companhia, a esp√©cie que foi modificada, ao ano em que o transg√™nico foi constru√≠do, e qual constru√ß√£o √© aquela dentre todas as que a empresa possui. Ou seja, tudo aquilo que um c√≥digo de barras em um transg√™nico precisa ter.

Código de Barras no DNA

Imagem modificada retirada de http://tinyurl.com/3g46mnj

No caso da imagem acima, o sistema bin√°rio de contagem foi utilizado, em que 1 √© a sequ√™ncia TGT e 0 √© TAC. Os n√ļmeros 1, 3 e 1 do nome da empresa, esp√©cie e constru√ß√£o g√™nica seriam consultados em banco de dados, de modo a identificar produtor do transg√™nico.

Esse tema foi at√© um projeto do iGEM, realizado pelo time de Hong Kong em 2010, cuja a grande ideia foi criar um processo que literalmente criptografa dos dados inseridos em DNA atrav√©s da a√ß√£o de uma recombinase. Al√©m disso desenvolveram um programinha que converte os dados de caracteres (char) √† n√ļmeros quatern√°rios, disso √† ATCG e depois √† uma vers√£o compactada da sequ√™ncia (Quanto maior e mais repetitivo o texto, melhor √© a compacta√ß√£o, se o texto for pequeno e pouco repetitivo a compacta√ß√£o vai fazer o trabalho oposto); vale a pena dar uma olhadinha (nesse link aqui √≥: http://2010.igem.org/Team:Hong_Kong-CUHK/Model).

Synbiobrasil no “alfabeto nucleot√≠dico” √©¬†TTAGTGCTTCGCTCACTCCTTCGGTCACTGACTCATTGAGTCCTTCGA (grande n√©!?). ūüôā

À Prova de Erros

Tanto em computadores como no sequenciamento gen√©tico erros podem acontecer, em que um 1 pode se tornar um 0 ou um A pode se tornar T (apesar de isso acontecer com muito mais frequ√™ncia no DNA). Em ambos usa-se os mesmos m√©todos que podem identificar o erro, e se for pequeno, repar√°-lo, possibilitando a leitura correta da informa√ß√£o. Esses m√©todos chamam-se Checagem de Pares e C√≥digos Convolucionais, e utilizam bits… ops, quer dizer, utilizam n√ļmeros secund√°rios usados para verificar a consist√™ncia dos dados. T√™m-se ent√£o os n√ļmeros fonte (f), que s√£o os que cont√©m a informa√ß√£o a ser lida e os n√ļmero de checagem de paridade¬†(p), estes √ļltimos t√™m valor 1 se um conjunto determinado de n√ļmeros fonte tiverem uma quantidade √≠mpar de 1s (“ums”) e zero se o contr√°rio.

Na checagem de pares o neg√≥cio funciona com n√ļmeros de checagem verificando blocos de c√≥digo.¬†Por exemplo: os n√ļmeros fonte 1001 (f1 f2 f3 f4) s√£o verificados por tr√™s n√ļmeros de checagem: p1, que verifica os tr√™s primeiros d√≠gitos, p2 que verifica a paridade do primeiro, segundo e quarto d√≠gitos, e p3 que verifica o primeiro, terceiro e quarto d√≠gitos. Temos ent√£o o seguinte c√≥digo de checagem de pares: 1001100¬†(n√ļmeros de checagem em it√°lico), pois:

  • f1(1) + f2(0) + f3(0) = p1 (1), pois se tem “um 1”
  • f1(1) + f2(0) + f4(1) = p2 (0), pois se tem “dois 1s”
  • f1(1) + f3(0) + f4(1) = p3 (0), pois se tem “dois 1s”

Durante a leitura se n√£o houver correla√ß√£o entre os n√ļmeros de checagem e fonte, √© poss√≠vel dizer onde aconteceu o erro (caso o erro n√£o seja generalizado). No exemplo foi utilizado um bloco de tamanho 4, mas ele pode ser maior, o que aumenta tamb√©m o tamanho do c√≥digo de checagem.

Utilizando C√≥digos de Convolu√ß√£o o processo √© bem parecido, mas n√£o ocorre em blocos, nele cada fn possui um pn que verifica os dois n√ļmeros fonte predecessores. Por exemplo, o n√ļmero 1011 ficaria: 11011110 (f1 p1 f2 p2 f3 p3 f4 p4), pois:

  • f1(1) = p1(1), pois se tem “um 1”
  • f1(1) + f2(0) = p2(1), pois se tem “um 1”
  • f2(0) + f3(1) = p3(1), pois se tem “um 1”
  • f3(1) + f4(1) = p4(0), pois se tem “dois 1s”

Ensinando o computador a fazer os cálculos, utilizando esses dois métodos, e fazendo a conversão de zeros e uns para nucleotídeos (e vice-versa) é possível criar um sistema de leitura do sequenciamento genético do código de barras à prova de erros, preservando a informação original inserida na célula.

DNA “Zipado”

Assim como muita coisa na biologia sint√©tica, os mesmos princ√≠pios da computa√ß√£o tamb√©m podem ser aplicados na decodifica√ß√£o de informa√ß√Ķes inseridas em DNA. O mesmo algoritmo de compacta√ß√£o de arquivos usado na computa√ß√£o tamb√©m pode ser usado para compactar as informa√ß√Ķes a serem inseridas em DNA, salvando espa√ßo, tempo de leitura e dinheiro no bolso das empresas. √Č o amplamente conhecido Algoritmo de Codifica√ß√£o de Huffman¬†(veja o link!), que se baseia no encurtamento de c√≥digos bastante frequentes de um arquivo atrav√©s de um algoritmo recursivo que constr√≥i a “√Ārvore de Huffmam“, uma ramifica√ß√£o bin√°ria de n√≥s de dados que cont√©m informa√ß√Ķes relativas √†s frequ√™ncias de caracteres. √Č preciso um pouco de conhecimento de programa√ß√£o para entender melhor como ele funciona; e isso foge um pouco do escopo desse post. Mas basta entender que voc√™ pode “zipar” as informa√ß√Ķes dentro do DNA!

Vale muito a pena conferir os links abaixo se você quiser saber mais sobre o assunto:

E até o próximo post!
Ou como se diria em 72 pares de base:
TAATTGTAGCCTACAATCGGACAATGAATGACGGAGTGCATCCTTCGTTCGGACAATGAATCGGTGAGTGTA!

Inside iGEM: Eventos Passados

iGEMA competi√ß√£o surgiu oficialmente em 2005, resultado do per√≠odo de atividades independentes (AIP) do MIT, em que a universidade, assim como muitas outras, abre as portas para cursos fora do per√≠odo letivo, na √©poca de f√©rias.¬† Respectivamente nos anos de 2003 e 2004, times de estudantes do pr√≥prio MIT desenvolveram osciladores biol√≥gicos com prote√≠nas-rep√≥rter fluorescentes (como vimos aqui no blog) e sistemas gen√©ticos para criar padr√Ķes celulares (Imagem abaixo) como os de “pontinhos” (chamados de polka dots) ¬†e de “alvo” (chamados de bull’s eye formation).

Polka Dots, Bull's Eye formations e o Coliroid Film

Ainda em 2004, junto com as atividades do AIP, foi criada a¬†“Summer Competition”, uma competi√ß√£o √† l√° iGEM mas com¬†apenas cinco universidades participantes, todas norte-americanas:Boston University, Caltech, o pr√≥prio MIT, Princeton University e a¬†University of Texas ¬†at Austin; foi a primeira verdadeira competi√ß√£o¬†de biologia sint√©tica.O grande destaque dessa competi√ß√£o pr√©-iGEM¬†foi a universidade do Texas, que segundo a p√°gina da¬†competi√ß√£o¬†criou o primeiro filme fotogr√°fico biol√≥gico do¬†mundo, o “Coliroid Film” (Imagem acima).

Esse evento acabou impulsionando Randy Rettberg, Tom Knight e Drew Endy a fundarem em 2005 o evento internacional que conhecemos hoje, com cerca de 13 times, com os mais variados projetos.

Destaques

Desde o per√≠odo de atividades independentes de 2004 at√© 2010, 434 times e projetos j√° participaram da competi√ß√£o, com id√©ias e solu√ß√Ķes¬† criativas e inovadoras para problemas da humanidade, o que torna dif√≠cil apresentar todos os destaques das competi√ß√Ķes al√©m dos finalistas e vencedores do Biobrick Trophy.

Logo no in√≠cio, em 2005, enquanto a¬†competi√ß√£o ainda estava engatinhando e os crit√©rios de julgamento ainda n√£o estavam bem consolidados, n√£o houve um BioBrick Trophy e houveram at√© algumas premia√ß√Ķes um tanto n√£o-convencionais em compara√ß√£o aos iGEM’s que se seguiram, como o “Best ‘Show Must Go On’ Moment” dado √† Princeton, o “George W.Bush Geography Award” (provavelmente uma brincadeira envolvendo as gafes geogr√°ficas do ex-presidente norte-americano) dado √† universidade de Zurique, e o “Best Project Name” dado¬† √† universidade de Toronto devido ao trocadilho com o nome do time e o projeto: “Cell-See-US”, que desenvolveu um tipo de term√īmetro com bact√©rias, fazendo uma analogia √† unidade Celsius de medida de temperatura.

Alguns destaques interessantes da competição desse ano foram:

  • Harvard: Criaram componentes que escrevem e apagam para um “caderno de desenho bacteriano”, utilizando luz e calor para respectivamente induzir a express√£o e degradar prote√≠nas rep√≥rter em uma placa.
  • UCSF (Universidade da Calif√≥rnia, S√£o Francisco): Desenvolveram term√īmetro biol√≥gico program√°vel, apesar de in√≠cio, segundo a wiki de 2006, ambicionarem apenas um detector biol√≥gico de temperatura. Ganhador do primeiro “Best Device Award” do iGEM.
  • Penn State: Construiram um mecanismo gen√©tico de controle quimiot√°xico usando BioBricks. Ganhador do “Best Brick Award”.
À partir de 2006 a competição passou a contar com o Bibrick Trophy, e com grande parte das regras de hoje. Um overview desde esse ano até hoje conta com os seguintes times que despontaram com os melhores projetos em cada ano:
(Clique no logo das universidade para ir para a wiki de cada projeto)
Terceiro Lugar Segundo Lugar Vencedor
2010
2009
2008
2007
2006

Durante a avaliação dos projetos são escolhidos 5 finalistas, dentre eles figuram com frequência a Imperial College of London e UC Berkeley, além das famosas como Cambridge e Harvard. Fama também o que a Universidade da Eslovênia Рdo modesto país europeu Рtem ganhado com essa competição: três vezes campeã e uma vez entre os 5 finalistas em 2007; contrariando a expectativa de reproduzir o ranking das melhores universidades do mundo, o que é confirmado pela forte presença das universidades asiáticas como a de Peking e a USTC.

√Č nesse ambiente plural e rico cientificamente (e porque n√£o culturalmente?) em que florescem os projetos em biologia sint√©tica mais impressionantes e competitivos todos os anos, mas muita coisa mudou desde 2006, e √© sobre isso que vamos falar no pr√≥ximo post da s√©rie Inside iGEM: O Futuro e Hoje.

Por falar em futuro, e o pa√≠s do futuro? Onde entra nessa hist√≥ria!? N√≥s aqui da uspl√Ęndia n√£o somos os primeiros a pensar no iGEM. Veremos tamb√©m a participa√ß√£o tupiniquim representada pela Unicamp em 2009 e agora em 2011. Ent√£o, at√© o pr√≥ximo post!

iGEM Videos

Antes do segundo post da s√©rie “Inside iGEM” que vem por a√≠ no blog, nada melhor do que ouvir os pr√≥prios estudantes dos times participantes para¬†descobrir como foram algumas das edi√ß√Ķes passadas. E o melhor, em v√≠deos feitos por eles mesmos!

Talvez o que mais mostre a experiência do que foi ter participado na elaboração de um projeto para a competição, no melhor espírito que os alunos de Graduação especialmente têm, seja o do time da Universidade de Southtampton de 2009.

The iGEM experience:
[youtube=http://www.youtube.com/watch?v=13SVRfxGZko]
(Repare de 1:50 a 2:10!)

√Č claro que quando se encabe√ßa um projeto, deve-se saber como “vender o pr√≥prio peixe”. H√° v√°rios v√≠deos extremamente bem explicativos no YouTube, al√©m da pr√≥pria wiki dos times, que explicam o que √© o projeto e mostram sua aplicabilidade (veja alguns links no final do post), mas particularmente, o da Universidade de Edinburgo, com as suas E.Coli’s “MineBusters”, √© o mais original j√° feito (at√© agora) para o iGEM. D√™em uma olhada:

The MineBusters:
[youtube=http://www.youtube.com/watch?v=QLsmjL3RIKw]

Al√©m da concep√ß√£o do projeto, a criatividade e bom humor (sem falar no talento) fazem parte de muitos times da competi√ß√£o. Outro v√≠deo musical, feito pelo time de Cambridge de 2010, mostra o drama da inser√ß√£o de genes em um vetor (um plasm√≠deo) solucionado atrav√©s do uso da t√©cnica de Gibson Assembly (T√©cnica que une dois fragmentos de DNA, not√°vel pelo n√ļmero e tamanho de fragmentos que pode associar com apenas uma √ļnica rea√ß√£o). Uma √≥tima can√ß√£o para voc√™ cantar aos seus colegas de laborat√≥rio (mas s√≥ se voc√™ cantar bem como a garota do v√≠deo!).

The Gibson Assembly Song:
[youtube=http://www.youtube.com/watch?v=WCWjJFU1be8&feature=related]

Links para outros vídeos interessantes:

Inside iGEM: A Competição

Esse √© o primeiro da¬†s√©rie de tr√™s posts “inside iGEM”, em que vamos mostrar um pouco mais a fundo sobre o que √© a competi√ß√£o e como ela funciona.

A Inscrição

Tudo come√ßa com a inscri√ß√£o de um time, que pode ser composto por estudantes de gradua√ß√£o de v√°rias √°reas: desde matem√°tica aplicada at√© a pr√≥pria Biologia, a id√©ia √© que quanto mais interdisciplinar for o grupo mais interessante poder√° ser o projeto. N√£o √© preciso que um time seja de uma √ļnica universidade ou que uma institui√ß√£o tenha apenas um time, basta apenas ter uma id√©ia, um projeto, e instrutores e orientadores para apoi√°-lo. E como nem s√≥ de flores vive o mais ambicioso projeto, √© preciso patroc√≠nio. √Č comum o patroc√≠nio ser p√ļblico, uma vez que as equipes representam universidades, mas existem muitos investimentos de empresas interessadas na pesquisa.

Para a inscri√ß√£o, √© cobrada uma taxa de dois mil d√≥lares mais cerca de $225USD por estudante para o atendimento nas competi√ß√Ķes regionais (uma modifica√ß√£o deste ano na competi√ß√£o) al√©m de mais $425USD para outros participantes. Os mesmos valores s√£o requisitados na fase mundial da competi√ß√£o.

O Evento no MIT.

O evento no MIT.

Escolas de nível médio (equivalentes às high schools americanas) também podem participar. A partir deste ano foi criada uma divisão para essa categoria, que tem participado desde 2008 no iGEM.

O Trabalho

Ap√≥s a forma√ß√£o de um time, s√£o dados aos estudantes inscritos um kit de partes biol√≥gicas do registro de partes biol√≥gicas padr√£o (ver √ļltimo post) em meados de abril . Eles devem usar essas partes e novas partes com design pr√≥prio para construir sistemas biol√≥gicos que operam em c√©lulas vivas, como os que j√° mostramos aqui¬†a nivel b√°sico em posts antigos (ver Osciladores, e Uma Bact√©ria que Conta).

Da data de entrega do kit até o fim de setembro, época em que a wiki (exemplo: Bactoblood, da Universidade de Berkley ) que cada time deve fazer é congelada, o time precisa enviar a descrição de seu projeto, propostas de segurança, que precisam ser aprovadas, documentar a parte padrão e registrar o BioBrick no registro de partes padrão. Então em outubro começa a fase regional, uma outra modificação da competição na edição deste ano, para depois haver então  o campeonato global no MIT.

A Competição

Em novembro ocorre o evento que dura cerca de dois dias na sede do MIT. Houve certa discuss√£o nas modifica√ß√Ķes que ocorreram da edi√ß√£o deste ano para mudar o local do evento para as ilhas Bahamas (!), contudo foi decidido por manter a competi√ß√£o em solo americano devido a poss√≠veis problemas log√≠sticos e de vistos (para que n√£o sabe as ilhas Bahamas¬†√© um pa√≠s!). Nas Bahamas ou n√£o, em toda competi√ß√£o do iGEM, como o pr√≥prio site oficial sobre o evento faz quest√£o de ressaltar, os estudantes al√©m de passar por uma experi√™ncia cultural, acad√™mica e profissional incr√≠vel, t√™m a oportunidade de se divertir um bocado (Veja um dos v√≠deos do iGEM de 2007).

As competi√ß√Ķes do iGEM, diferentemente das competi√ß√Ķes habituais, n√£o t√™m um foco principal competitivo, mas meritocr√°tico: os times n√£o s√£o √† priori julgados comparativamente, mas t√™m seus pr√™mios ganhos atrav√©s do comprimento de requisitos b√°sicos que fazem o grupo merecedor de uma medalha. Os crit√©rios de julgamento para conceder os tipos de medalhas aos grupos orbitam principalmente em torno do BioBrick e √† medida em que se conquista uma medalha melhor, as exig√™ncias do BioBrick tornam-se maiores. Em resumo os pr√©-requisitos s√£o:

Medalha de Bronze: Al√©m de realizar a inscri√ß√£o, ir ao evento e apresentar um p√īster, √© preciso detalhar no m√≠nino um novo BioBrick padr√£o no registro de partes ¬†cumprindo todas as normas estabelecidas.

O BioBrick Trophy.

o BioBrick Trophy.

Medalha de Prata: Demonstrar que o BioBrick funciona como esperado e caracterizar (i.e. explicar como funciona) a operação dele in vivo.

Medalha de Ouro: Caracterizar um BioBrick já existente ou melhorá-lo e colocá-lo de volta no registro de partes, e também desenvolver um documento com uma nova técnica padrão que ajude no design, ou caracterização, ou construção, ou análise, ou modelagem, ou simulação, ou compartilhamento (ufa!) de um BioBrick ou do dispositivo biológico envolvido. Além de tudo isso, outro requisito é a cooperação: ajudar outro time do iGEM; como por exemplo na caracterização de um BioBrick e na modelagem ou simulação do sistema da outra equipe competidora (companheira!?) é um grande contribuinte para o prêmio dourado.

Mas como toda boa competição, além das medalhas há uma avaliação do best of the bests dentre as categorias de projeto, podendo dar o título de Area Prize ao time com maior destaque em sua área. As áreas de premiação são:

  • Melhor projeto de Alimenta√ß√£o ou Energia (Best Food or Energy Project).
  • Melhor projeto Ambiental (Best Environment Project).
  • Melhor projeto de Sa√ļde ou Medicina (Best Health or Medicine Project).
  • Melhor projeto Industrial (Best¬† Manufacturing Project).
  • Melhor nova √Ārea de Aplica√ß√£o (Best New Application Area).
  • Melhor Avan√ßo Fundamental (Best Foundational Advance).
  • Melhor projeto de Processamento de Informa√ß√£o (Best Information Processing Project).

Há também prêmios especiais para destaques de projetos:

  • Melhor novo BioBrick Natural (Best New BioBrick Part, Natural).
  • Melhor novo BioBrick ou Dispositivo Artificial (Best New BioBrick Part or Device, Engineered).
  • Melhor avan√ßo em Pr√°ticas Humanas (Best Human Pratices Advance).
  • Melhor Medida Experimental (Best Experimental Measurement).
  • Melhor Modelo (Best Model).
  • Melhor Wiki (Best Wiki).
  • Melhor Poster (Best Poster).
  • Melhor Apresenta√ß√£o (Best Presentation).

Os maiores pr√™mios, baseados no desempenho geral na competi√ß√£o, s√£o os trof√©us de primeiro lugar (imagem acima) e primeiro de vice-campe√£o e segundo vice-campe√£o.¬†Al√©m disso, existe tamb√©m um pr√™mio especial para a √°rea de desenvolvimento de ferramentas de softwares, cujas medalhas s√£o “coloquialmente chamadas de mousepads” como o site oficial jocosamente menciona.

Após o evento, os participantes são fortemente encorajados a escrever um artigo e publicá-lo em revistas como o Journal of Biological Engineering, e a ir a conferências como a conferência anual do Institute of Engineering and Technology.

Continue lendo…

iGEM: International Genetically Engineered Machine competition

 

Ol√° pessoal,

Sou a Marianna, este é meu terceiro ano da graduação em Ciências Biológicas pela USP РUniversidade de São Paulo. Também sou aluna de iniciação científica na área de microbiologia aplicada e biotecnologia, no Instituto de Ciências Biomédicas (ICB) da USP.

Gostaria de comentar um pouco sobre um evento de Biologia Sintética que acontece anualmente e que é amplamente reconhecido pela comunidade científica: o iGEM.

Os participantes s√£o alunos de gradua√ß√£o, que, orientados por alunos mais experientes, encaram o desafio de compreender, projetar e implementar novos sistemas biol√≥gicos sint√©ticos utilizando partes-padr√£o de DNA e oper√°-los em c√©lulas vivas, com o objetivo de solucionar problemas no mundo (e.g. alimenta√ß√£o, energia, meio ambiente, medicina, processamento de informa√ß√Ķes), tendo como base princ√≠pios de engenharia. O Jamboree, no qual as equipes apresentam seus projetos e resultados, √© o maior evento de synbio no mundo, onde os estudantes s√£o premiados com trof√©us e medalhas em v√°rias categorias. O iGEM teve in√≠cio em Janeiro de 2003, e em 2004 tinha 5 equipes. Este n√ļmero vem crescendo, com 130 equipes em 2010.¬†Os estudantes recebem um kit com as melhores partes gen√©ticas dispon√≠veis no in√≠cio de cada competi√ß√£o e, posteriormente as partes que eles constru√≠ram v√£o para a ‚Äúcole√ß√£o de partes‚ÄĚ, onde no futuro outros estudantes podem fazer novas constru√ß√Ķes.

Exemplos de projetos de sucesso incluem:

-Codificação e armazenamento de dados em E. coli (bio-criptografia) (http://2010.igem.org/Team:Hong_Kong-CUHK)

-Resolu√ß√£o do quebra-cabe√ßas Sudoku por E. coli (processamento de informa√ß√Ķes) (http://2010.igem.org/Team:UT-Tokyo)

-Controle da ordem e sequ√™ncia de rea√ß√Ķes em uma via biossint√©tica em particular, de forma a aumentar a velocidade e efici√™ncia da rea√ß√£o (http://2010.igem.org/Team:Slovenia/PROJECT/introduction)

-Descontaminação de áreas com metais pesados (http://2010.igem.org/Team:Peking)

-Sensor de fertilidade do solo, de forma a mapear áreas com concentração de nutrientes, reduzindo malefícios ao meio ambiente e gastos de agricultores (http://2010.igem.org/Team:BCCS-Bristol)

– E. coli produtora de diferentes pigmentos em resposta a diferentes concentra√ß√Ķes de um indutor (http://2009.igem.org/Team:Cambridge)

-Construção de promotores sintéticos para permitir monitoramento de várias vias na célula (http://2009.igem.org/Team:Heidelberg)

РDesenvolvimento de uma vacina sintética composta de imunobricks, que estimulam formação de anticorpos (http://2008.igem.org/Team:Slovenia)

Desta forma, é possível perceber que mesmo alunos de graduação, utilizando técnicas aparentemente simples de biologia sintética, podem produzir resultados incríveis e extremamente aplicáveis.

BioBricks: fabricação de uma parte padrão.

At√© agora comentamos sobre a possibilidade de juntar diferentes componentes utilizando o padr√£o t√©cnico de montagem dos BioBricks. Mas neste post vou comentar sobre a fabrica√ß√£o de uma parte padr√£o. No futuro, eu¬†pretendo comentar sobre a s√≠ntese de DNA sint√©tico, mas agora¬†vou explicar como montar um BioBrick utilizando o m√©todo de PCR. O aparelho para realizar um PCR, o termociclador,¬†est√°¬†presente na maioria dos laborat√≥rios de biologia molecular, e hoje se apresenta como uma ferramenta b√°sica para este tipo de atividade. Existem centenas de livros e sites na Internet que podem te familiarizar com a t√©cnica. Primeiramente, um BioBrick¬†pode ser constru√≠do via PCR se existe algum molde de DNA do qual o BioBrick¬†possa ser amplificado (por ex., um gene de alguma bact√©ria)¬†ou se a parte √© pequena o suficiente que possa ser criada atrav√©s do alinhamento e extens√£o do primer (iniciador). Nos dois casos √© necess√°rio adicionar na extremidade 5′ dos primers as sequ√™ncias referentes aos s√≠tios das enzimas de restri√ß√£o presentes nos BioBricks, os sufixos e prefixos (ver post anterior).

A constru√ß√£o de BioBricks contendo sequ√™ncias codificadoras de prote√≠nas requer um sufixo e um prefixo um pouco mais especializados por duas raz√Ķes:

1. o prefixo é alterado para garantir o espaçamento entre o sítio de ligação do ribossomo e o códon ATG de início.

2. BioBricks que codificam proteínas possuem, por padronização, dois códons de sequência TAA de parada.

Ao¬†construir os primers, basicamente, √© necess√°rio “copiar e colar” a seguinte sequ√™ncia de¬†31 bp¬†no fim 5′ no seu primer upstream (ou iniciador universal) desenhado para o seu fragmento de DNA de interesse:

5′ —> 3′
GTT TCT TCG AAT TCG CGG CCG CTT CTA G ATG…
start codon (no caso de um gene)
E “copiar e colar” os seguintes 35 bp no fim 5′ do seu primer downstream (iniciador reverso):

5′ —> 3′
GTT TCT TCC TGC AGC GGC CGC TAC TAG TA TTA TAA….
duplo stop codon!

A estas sequências deve-se somar aproximadamente 20 bp de sequência de primer relativa a região codificadora. Para este tipo de clonagem se utiliza uma Taq polimerase com alta fidelidade e um kit de clonagem TOPO-TA cloning.

Claro que todas as outras precau√ß√Ķes para se desenhar um primer ainda s√£o v√°lidas, como a verifica√ß√£o de s√≠tios de restri√ß√£o nas sequ√™ncias. Para mais detalhes, veja o protocolo disponibilizado para a fabrica√ß√£o de BioBricks.