Computadores bacterianos

De acordo com o verbete da wikipedia, um computador é uma máquina programável desenhada para, automaticamente, realizar um sequência de operações aritiméticas ou lógicas. Um computador pode prover-se de inúmeros atributos, dentre eles armazenamento de dados, processamento de dados, cálculo em grande escala, desenho industrial, tratamento de imagens gráficas, realidade virtual, entretenimento e cultura. Os primeiros computadores analógicos surgiram no século XVII e eram capazes de realizar as funções básicas de somar, subtrair, multiplicar e dividir. Mas foi na II Guerra Mundial, em meados do século XX, que realmente nasceram os computadores atuais. A Marinha dos Estados Unidos, em conjunto com a Universidade de Harvard, desenvolveu o computador Harvard Mark I, projetado pelo professor Howard Aiken, com base no calculador analítico de Babbage. O Mark I ocupava 167m2 e pesada cerca de 30 tonelada aproximadamente, conseguindo multiplicar dois números de dez dígitos em três segundos.Seu funcionamente era parecido com uma calculadora simples de hoje em dia. Nem é preciso falar o quanto esta tecnologia se desenolveu até hoje, em que hoje se discuti processadores quânticos e se faz computação em nuvem. Uma plataforma diferente das “baseadas no silício”, que estamos acostumados, são os biocomputadores. Em 1994, em um experimento muito elegante, Leonard Adleman desenvolveu o primeiro experimento envolvendo um computador de DNA para resolver o problema do Caminho Hamiltoniano: um problema que envolve caminhos hamiltonianos é o problema do caixeiro viajante, em que um caixeiro deseja visitar um conjunto de N cidades (vértices), passando por cada cidade exatamente uma vez, fazendo o caminho de menor tamanho possível (Figura 1).

 

Figura 1. O grafo em vermelho é hamiltoniano.

Cada bola é um nó e cada flecha é uma aresta. Existem multiplas possibilidades de construir um computador baseado em DNA, em que cada um possui suas vantagens e desvantagens. A maioria deles funciona utilizando as portas lógicas (AND, OR, NOT) associadas a lógica digital utilizando como base o DNA, como por exemplo, o contador bacteriano . Porém os primeiros computadores moleculares baseados em DNA, são reações in vitro utilizando, por exemplo, enzimas de restrição, ligases, e DNA (Benenson et al. 2001). Através da mistura desse componentes e reações em cascada de digestão, ligação e hibridização, o output final é uma molécula detectável que representa o resultado computacional. Em 1994, Leonard Aldleman foi capaz desenvolver um computador in vitro baseado em DNA para solucionar o problema do Caminho Hamiltoniano (Figura 1), porém apenas em 2009, Baumgardner e colaboradores conseguiram resolver um problema complexo in vivo, em E. coli. Porém, para entender, é necessário uma série de abstrações para tornar sequências de DNA em vértices e arestas de um caminho hamiltoniano (ver Figura 2). A primeira abstração trata segmentos de DNA como as arestas de um determinado grafo. As arestas de DNA são flanqueados por sítios hixC que podem ser embaralhados por um recombinase Hin, criando diversas ordens e orientações randômicas para as arestas do grafo. A segunda abstração está relacionada com os nós, com exceção do nó terminal, em que um nó é um gene divido ao meio por uma sequência hixC. Os autores conseguiram construir enzimas funcionais portando essas sequências codificadas no DNA. Dessa maneira, a primeira metade (5´) de um nó é encontrada na aresta de DNA que termina em um nó, enquanto a segunda metade (3´) do gene é encontrado em uma aresta de DNA que se origina no nó. Calma, realmente não é fácil entender, é preciso pensar e abstrair, veja a figura 2.


Figura 2. Construção de DNA que codificam um problema do Caminho Hamiltoniano com três nós. a. O grafo contendo o caminho Hamiltoniando começa no nó RFP, procedendo para o nó GFP e terminando no nó TT. b. Construção ABC representam a solução para o problema dos três nós. Os três fragmentos de DNA flanqueado por hixC estão na ordem e orientação corretas, de maneira que os genes GFP e RFP estão intactos. ACB possui o gene RFP intacto, porém o gene GFP está errado, por fim, a construção BAC não possue nenhum gene intacto.

A Figura 2a mostra o grafo com os 3 nós e as 3 arestas que foram escolhidas para serem codificados no computador bacteriano. O gráfico contêm um único caminho hamiltoniano que começa no nó RFP, viajando pela aresta A até o nó GFP, e utilizando a aresta B até alcançar o nó final TT. A aresta C, the RFP até TT é um detrator. A Figura 2b ilustra como as construções de DNA foram utilizadas para solucionar o problema do Caminho Hamiltoniano com um controle positivo e duas configurações sem soluções. Já que as soluções precisam originar no nó RFP e terminar no nó GFP, a aresta A de DNA contêm na extremidade 3´a metade de RFP seguida por a extremidade 5´de GFP. A aresta B de DNA se origina em GFP e termina em TT, dessa maneira, esse fragmento de DNA possui 3´GFP seguido de um terminado de transcrição duplo. A aresta C se origina em uma metade 3´ de RFP e termina em TT. Finalmente, com os genes codificadores para RFP e GFP estão intactos, com promotores e RBS, e seguintes de um terminador de transcripção, colônias ABC expressam fluorescência vermelha e verde, dessa maneira, possuem aparência amarela.

Para concluir a abstração eu gosto de imaginar que a recombinase Hin é o caxeiro viajante que faz o seu caminho pelo DNA e a sequência de DNA contem o mapa do caminho realixado.

A programação de bacteria para computar soluções de problemas complexos podem oferecer as mesmas vantagens dos computadores atuais que estamos acostumados, porém, com as seguintes características adicionais: (i) sistemas bacterianos são autônomos, eliminando a necessidade de intervenção humana, (ii) computadores bacterianos podem se adaptar a condições flutuantes, evoluindo para resolver desafios de determinados problemas e (iii) o crescimento exponencial de bactérias continuamente aumente o número de processadores trabalhando em um problema (Baumgardner et al., 2009). Sem contar que eles ainda poderiam fazer fotossíntese…

Adleman LM: Molecular computation of solutions to combinatorial problems. Science 1994, 266:1021-1024.

Benenson Y, Paz-Elizur T, Adar R, Keinan E, Livneh Z, Shapiro E: Programmable and autonomous computing machine made of biomolecules. Nature 2001, 414:430-434.

Baumgardner , J et al. Solving a Hamiltonian Path Problem with a bacterial computer. J. Biol. Eng. 2009, 24;3:11.

“O que é Biologia Sintética?”: Reloaded

Como já foi postado aqui, “o que é biologia sintética?” é uma pergunta pouco difícil de definir. Synbio é uma área de intersecção entre Biologia de Sistemas, Engenharia Genética, Biofísica, Biocomputação, Engenharia Metabólica, Biologia Molecular e áreas relacionadas afins. Portanto, não é nada fácil dizer  que “aquilo” ou “isto” é biologia sintética porque apontar para algo em Synbio é também apontar para outras áreas mais veteranas no mundo da ciência.

Mas então que diabos é isso tudo!? Uma grande “mistureba generalizada de todas as coisas”? Sim, mas não só isso.

Antes de falar do grande aspecto original que a Biologia Sintética tem – que é o detalhe “revolucionário” da coisa toda – deve-se fazer reconhecer algo que ela faz bem melhor do que a engenharia genética: o Design. O conceito de Design na engenharia de um novo sistema sintético é bem amplo, indo desde um design de proteínas (como proteínas quimera, como light switches), passando pelo próprio design do código genético (similar à escrita de um código de programação de computador mesmo), até ao design de todo o sistema biológico baseado na construção gênica feita (um exemplo bem visível disso é do projeto do iGEM com objetivos de criar uma bactéria resolvedora de Sudoku).

A reinvenção das capacidades do design de um sistema biológico foram possíveis não somente devido à novas tecnologias, mas sobretudo devido a uma nova abordagem com a cara dos nossos tempos super-informacionais: construção (biológicas, claro) automatizada e padronização das construções (os biobricks, por exemplo). Isso facilita enormemente o desenvolvimento de diversos dispositivos sintéticos e designs. Além disso, outra fundamentação da biologia sintética seria a abstração, a capacidade de abstrair problemas biológicos em uma visão mais simples, com base em toda a teoria já existente em outras áreas, como computação e a engenharia elétrica (não é à toa que Tom Knight e Randy Rettberg, dois engenheiros elétricos, fizeram parte da criação do iGEM).

Fica muito mais fácil entender tudo isso nas palavras do próprio Drew Andy – um dos pesquisadores que ajudou a fazer o parto da Biologia Sintética – nesse vídeo bem informal filmado em sua própria sala no MIT. Vale a pena conferir! 🙂

(OBS: é bem informal mesmo!)

DNA como Código de Barras

DNA barcodeDesde o incrível advento do sequenciamento gênico lá pelos idos dos anos 70 o volume de dados obtidos das mais variadas combinações de nucleotídeos encontradas na natureza é estonteante. Fazendo um cálculo bem simples com só cinco nucleotídeos, temos 3125 combinações diferentes das letrinhas A,T,C e G!

É lógico que hoje também conhecemos uma enorme quantidade de padrões dessas letrinhas que nos dizem: “Olha, aqui termina um gene!”, ou “É aqui que o ribossomo gruda!”, entre outras coisas. O ruim é que só à partir do DNA é bem mais trabalhoso e difícil dizer de qual criatura vieram aquelas informações encriptadas ali quando comparada à mera observação daquele ser vivo. E em alguns casos, mesmo que se conheça de onde vem o DNA, há a dúvida se ele veio mesmo de onde parece ter vindo: como se poderia ter certeza, por exemplo, se aquela bonita carteira de couro que te deram de presente não veio de uma espécie de jacaré em extinção em vez de um réptil criado em cativeiro!? A grande ideia é fazer o mesmo que você faz quando vai ao supermercado: em vez de escanear cada dobra da embalagem, abri-la, fazer uma fina análise do conteúdo, além de ter que sair por aí perguntado quanto custa, basta colocar aquela figurinha cheia de barras que existe em algum canto da embalagem num detector e pronto! Você passa a saber com rapidez do que se trata aquilo. No código genético tenta se fazer a mesma coisa.

A Vida Rotulada

A região do DNA (lócus) que deve ser usada para ser um “código de barras” (CB) tem que ao mesmo tempo ser conservada e variável, do mesmo modo que os CB’s são todos barrinhas pretas de mesmo tamanho, mas com comprimentos e espaçamentos variáveis. Essa região pode variar com os reinos dos seres vivos, mas no caso dos eucariotos, a região de 648 pares de bases do DNA mitocondrial que codifica a subunidade 1 da enzima citocromo mitocondrial C oxidase, é hoje amplamente usada como código de barras. O DNA mitocondrial é ideal para ser usado como CB uma vez que sua taxa de mutação nos seres vivos durante a evolução é muito alta, o que resulta em uma variação significativa das sequências entre as espécies.

Rotulando uma parte pelo todo é muito mais fácil para os biólogos associarem uma marca única de cada espécie às suas já elaboradas classificações do zoológico da vida, além de tornar muito mais fácil o controle, detecção e proteção de várias espécies de animais. Exitem grandes bancos de dados com um número crescente de DNA Barcodes (códigos de barras de DNA), um dos mais notórios é o projeto International Barcode of Life (Com site muito bonito aliás!) que já conta – pelo menos até agora pouco quando dei uma olhada – cerca de 1 milhão e 330 mil espécies no catálogo.

Código de Barras Literal

Aqui é o ponto em que a biologia sintética, ou pelo menos a engenharia genética, entra nisso tudo: como rotular os transgênicos? Bem, esse é um probleminha que foi bem discutido nos últimos anos que se passaram, principalmente porque as indústrias não queriam facilitar que sua tecnologia fosse copiada por outras companhias, enquanto governos e opinião pública queriam uma regulamentação que gerassem medidas que discriminassem um produto transgênico de um não-transgênico – um pouco por motivos ideológico-sociais, mas principalmente por motivos ecológicos: tornando a possibilidade de rastrear os culpados na hipótese de uma contaminação em certeza, haveria uma maior pressão para execução adequada das medidas de segurança impostas pela lei.

Foi aí então que criaram – ou melhor patentearam – uma padronização para códigos de barras bem interessante, que além de naturalmente tornar a identificação do transgênico muito mais fácil à partir de uma simples amostra de DNA, mantém a tecnologia em segredo e ainda conta com os mesmos processos utilizados em computador para correção de dados e compactação dos mesmos. Além dessa padronização que iremos explicar adiante, o próprio pessoal do Registro de Partes Padrão desenvolveu um Barcode para os Biobricks, que não é tão sofisticado, mas que corresponde à sua finalidade.

Escrevendo Com Quatro Letras

Para escrever textos com apenas quatro letras é muito simples se você sabe escrever

Imagem modificada retirada de http://tinyurl.com/3g46mnj

letras com números. Os computadores usam uma tabela que traduz o valores numéricos (ou melhor, bits) associados à um caractere do alfabeto alfanumérico: a famosa tabela ASCII. Para escrever letras no DNA então é muito mais fácil que no computador, principalmente porque ele utiliza o sistema binário de contagem, enquanto no DNA é possível usar o quaternário, com os 4 “números” possíveis: A, T, C e G, valendo 0, 1, 2, e 3 respectivamente (ver figura ao lado).

Com isso foi possível criar a seguinte (ver imagem abaixo) construção não-codificante de DNA que conta com informações relativas à por exemplo o nome da companhia, a espécie que foi modificada, ao ano em que o transgênico foi construído, e qual construção é aquela dentre todas as que a empresa possui. Ou seja, tudo aquilo que um código de barras em um transgênico precisa ter.

Código de Barras no DNA

Imagem modificada retirada de http://tinyurl.com/3g46mnj

No caso da imagem acima, o sistema binário de contagem foi utilizado, em que 1 é a sequência TGT e 0 é TAC. Os números 1, 3 e 1 do nome da empresa, espécie e construção gênica seriam consultados em banco de dados, de modo a identificar produtor do transgênico.

Esse tema foi até um projeto do iGEM, realizado pelo time de Hong Kong em 2010, cuja a grande ideia foi criar um processo que literalmente criptografa dos dados inseridos em DNA através da ação de uma recombinase. Além disso desenvolveram um programinha que converte os dados de caracteres (char) à números quaternários, disso à ATCG e depois à uma versão compactada da sequência (Quanto maior e mais repetitivo o texto, melhor é a compactação, se o texto for pequeno e pouco repetitivo a compactação vai fazer o trabalho oposto); vale a pena dar uma olhadinha (nesse link aqui ó: http://2010.igem.org/Team:Hong_Kong-CUHK/Model).

Synbiobrasil no “alfabeto nucleotídico” é TTAGTGCTTCGCTCACTCCTTCGGTCACTGACTCATTGAGTCCTTCGA (grande né!?). 🙂

À Prova de Erros

Tanto em computadores como no sequenciamento genético erros podem acontecer, em que um 1 pode se tornar um 0 ou um A pode se tornar T (apesar de isso acontecer com muito mais frequência no DNA). Em ambos usa-se os mesmos métodos que podem identificar o erro, e se for pequeno, repará-lo, possibilitando a leitura correta da informação. Esses métodos chamam-se Checagem de Pares e Códigos Convolucionais, e utilizam bits… ops, quer dizer, utilizam números secundários usados para verificar a consistência dos dados. Têm-se então os números fonte (f), que são os que contém a informação a ser lida e os número de checagem de paridade (p), estes últimos têm valor 1 se um conjunto determinado de números fonte tiverem uma quantidade ímpar de 1s (“ums”) e zero se o contrário.

Na checagem de pares o negócio funciona com números de checagem verificando blocos de código. Por exemplo: os números fonte 1001 (f1 f2 f3 f4) são verificados por três números de checagem: p1, que verifica os três primeiros dígitos, p2 que verifica a paridade do primeiro, segundo e quarto dígitos, e p3 que verifica o primeiro, terceiro e quarto dígitos. Temos então o seguinte código de checagem de pares: 1001100 (números de checagem em itálico), pois:

  • f1(1) + f2(0) + f3(0) = p1 (1), pois se tem “um 1”
  • f1(1) + f2(0) + f4(1) = p2 (0), pois se tem “dois 1s”
  • f1(1) + f3(0) + f4(1) = p3 (0), pois se tem “dois 1s”

Durante a leitura se não houver correlação entre os números de checagem e fonte, é possível dizer onde aconteceu o erro (caso o erro não seja generalizado). No exemplo foi utilizado um bloco de tamanho 4, mas ele pode ser maior, o que aumenta também o tamanho do código de checagem.

Utilizando Códigos de Convolução o processo é bem parecido, mas não ocorre em blocos, nele cada fn possui um pn que verifica os dois números fonte predecessores. Por exemplo, o número 1011 ficaria: 11011110 (f1 p1 f2 p2 f3 p3 f4 p4), pois:

  • f1(1) = p1(1), pois se tem “um 1”
  • f1(1) + f2(0) = p2(1), pois se tem “um 1”
  • f2(0) + f3(1) = p3(1), pois se tem “um 1”
  • f3(1) + f4(1) = p4(0), pois se tem “dois 1s”

Ensinando o computador a fazer os cálculos, utilizando esses dois métodos, e fazendo a conversão de zeros e uns para nucleotídeos (e vice-versa) é possível criar um sistema de leitura do sequenciamento genético do código de barras à prova de erros, preservando a informação original inserida na célula.

DNA “Zipado”

Assim como muita coisa na biologia sintética, os mesmos princípios da computação também podem ser aplicados na decodificação de informações inseridas em DNA. O mesmo algoritmo de compactação de arquivos usado na computação também pode ser usado para compactar as informações a serem inseridas em DNA, salvando espaço, tempo de leitura e dinheiro no bolso das empresas. É o amplamente conhecido Algoritmo de Codificação de Huffman (veja o link!), que se baseia no encurtamento de códigos bastante frequentes de um arquivo através de um algoritmo recursivo que constrói a “Árvore de Huffmam“, uma ramificação binária de nós de dados que contém informações relativas às frequências de caracteres. É preciso um pouco de conhecimento de programação para entender melhor como ele funciona; e isso foge um pouco do escopo desse post. Mas basta entender que você pode “zipar” as informações dentro do DNA!

Vale muito a pena conferir os links abaixo se você quiser saber mais sobre o assunto:

E até o próximo post!
Ou como se diria em 72 pares de base:
TAATTGTAGCCTACAATCGGACAATGAATGACGGAGTGCATCCTTCGTTCGGACAATGAATCGGTGAGTGTA!

Scinamate Synthetic Biology

Vídeo legal sobre SynBio

[youtube=http://www.youtube.com/watch?v=xOx3B2Z_qqE]

[twitter-follow screen_name=’MnlimasBio’]

Light Switches: Um Review

ResearchBlogging.orgJá tratamos nesse blog de um dispositivo simples, mas engenhoso, para a transdução de um sinal luminoso em uma resposta genética desejada, no caso um switch de luz vermelha. Mas podemos abranger o conceito de switch de luz para uma variada gama de mecanismos que a própria natureza esculpiu durante os milhares de anos que teve para se divertir sozinha antes que nós aprendêssemos a modificá-la.

Os mecanismos mais óbvios, que conhecemos bem antes de termos conhecimento da existência de uma célula, são os das plantas. Apesar de pensarmos nesses seres vivos como a fonte mais provável das ferramentas que precisamos para construir um light switch, a biologia sintética utilizou até agora principalmente os dispositivos fotossensíveis de microorganismos fototróficos e quimiotróficos, presentes em uma grande quantidade de bactérias.

As funções de muitos fotorreceptores ainda não são muito claras, mas alguns exemplos na natureza da atividade desses mecanismos vão desde a regulação da motilidade celular, formação de pigmentos, reparo de DNA, resposta ao stress , à até “comportamentos multicelulares”, como a formação de biofilmes e de corpos de frutificação, como por exemplo a Stigmantella aurantiaca.

Corpo de frutificação da Stigmantella aurantiaca.

Corpo de frutificação de Stigmantella aurantiaca. Retirado da publicação de van der Hornst et al, mencionada no final do post.

A grande maioria das proteínas fotossensíveis que a seleção natural pôde criar nesses milhões de anos, e que até agora conhecemos, pode ser classificada em seis famílias bem definidas, baseada na estrutura do cromóforo absorvedor de luz, que podem ser: as famosas rodopsinas, os aqui já conhecidos fitocromos, as xantopsinas, os criptocromos, as também famosas fotropinas e as proteínas de domínio BLUF (blue light sensing using flavin (FAD), domínio utilizador de flavina sensível à luz azul).

A natureza é sutil; ela parte de princípios básicos e com eles (utilizando um bocado de tempo) cria as mais variadas soluções para um mesmo problema. Com os fotorreceptores não é diferente. Uma procura de similaridade de sequências que codificam esses seis tipos de fotorreceptores no mecanismo de busca protein BLAST do NCBI revela uma grande quantidade de sequências similares nos genomas de diferentes espécies, indicando um vasto número de receptores ainda não caracterizados em diversos microorganismos. Um exemplo dessa busca pode ser visto da lista deste link: Chemotrophic organisms containing protein photoreceptor domains.

O princípio básico dos fotorreceptores é: uma estrutura molecular que contenha um ou mais domínios que captam a luz (input) e outro(s) que transforme(m) isso em um sinal intracelular (output). Os domínios de input ligam-se a cofatores ou cromóforos, resultando em uma molécula capaz de absorver luz UV ou visível. O domínio do output pode possuir uma atividade enzimática, proteína-ligante, ou DNA-ligante.  Vejamos alguns domínios de input e de output comumente encontrados in natura.

Domínios de Input Domínios de Output
AppA: Anti-repressor de pigmentos fotossintéticos. O AppA foi a primeira proteína com domínio BLUF caracterizada em Rhodobacter sphaeroides. Absorve na região dos 446 nm com o seu cromóforo FAD. Além de sensível à luz, está envolvida em reações redox.BLUF: Um domínio presente em várias proteínas fotoativas, sua estrutura é similar, mas com um mecanismo funcional totalmente diferente, ao domínio PAS.

LOV: Uma subclasse do domínio PAS, nomeado LOV devido ao tipo de sinal que esse domínio detecta: Luz-Oxigênio-Voltagem (light-oxygen-voltage). Esse tipo de domínio foi descoberto em fototropinas de plantas e mais recentemente em proteínas bacterianas. Um tipo de domínio bem “popular”.

PAS: De “Per-Arnt-Sim”, três reguladores transcricionais que contêm esse tipo de domínio. Outro tipo de domínio bem “popular” no quesito receptor de luz. Muitas proteínas com domínio PAS são conhecidas por transmitir o seu sinal associando-se a cofatores.

Fitocromo: Receptor de luz vermelha e infravermelho encontrado em plantas e bactérias, ligando-se em uma cromóforo de bilina (Lembra do red light switch? A Ficocianobilina é um desses cromóforos).

PYP: De photoactive yellow protein (proteína fotoativa amarela). Um receptor de luz citoplasmático que usa ácido p-coumárico como seu cromóforo. Sua absorção máxima é em 446 nm.

Rodopsina: Proteína composta por um conjunto de sete hélices intermembrana (ver imagem na tabela abaixo), ligando-se a um cofator retinal em seu centro hidrofóbico, absorvendo em maior parte luz verde. Há uma grande quantidade de estudo sobre ela.

YtvA: Um bem caracterizado domínio fotoreceptor de luz azul em Bacillus subitilis. Possui um domínio LOV que se liga ao cromóforo monoflavina (FMN), o que resulta numa absorção máxima em torno de 449 nm.

EAL: Domínio com atividade enzimática diguanilato-fosfodiesterase (traduzindo: envolvido na hidrólise de di-GMP cíclico, um importante sinalizador intracelular). Chama-se EAL por causa de sua sequência conservada de resíduos, mas também conhecido como DUF2.GAF: Domínio com atividade de adenilato-ciclase, guanilato-ciclase, e fosfodiesterase. Liga-se à um cofator bilina em alguns fitocromos.GGDEF: Similar ao EAL, possui atividade de ciclase em diguanilatos (di-GMP). Também possui seu nome devido à sua sequência conservada, conhecido também por DUF1.

HisKA: Domínio fosfoaceptor e dimerizador de proteínas histidina-quinases, importantes proteínas na sinalização intracelular.

HTH: Domínio de ligação ao DNA de reguladores de transcrição bacterianos. Eles se ligam ao DNA via seu motivo (sequência específica de aminoácidos) helix-turn-helix (hélice-dobra-hélice).

STAS: O domínio STAS, cujo nome significa domínio transportador de sulfato e antagonista de fatores anti-sigma (traduzindo: promove a atividade do tal fator de transcrição sigma), é o domínio de output do bem caracterizado YtvA, mas também encontrado em outros fotoreceptores.

Sabendo como as coisas são naturalmente, é possível juntar diferentes peças desse zoológico de domínios proteicos e formar diferentes light switches. Vejamos por exemplo o red light switch: basta juntar um domínio input de fitocromo e um output de ligação ao DNA, no caso o GAL4. Para sintetizar um switch de luz azul, verde, amarelo, e etc, o princípio fundamental é o mesmo: basta montar um input e um output desejados. O resto é pura metodologia e testes. Alguns exemplos de construções naturais podem ser:

Combinações naturais de diferentes domínios Input e Output.

Imagem modificada retirada da referência deste post (van der Hornst et al.).
 

Como se pode ver, o domínio de input LOV parece ser o mais versátil, o que talvez explique a sua “popularidade” no mundo bacteriano dos domínios fotossensíveis. Encontra-se um LOV input ligado à vários tipos diferentes de outputs.

Uma coisa interessante a se levar em conta nessas construções naturais é o tempo de alternância entre os diferentes estados dos fotorreceptores, que como vimos no red light switch, se resume (na maioria dos casos) a um estado “ativo” quando exposto a luz e um “inativo” quando no escuro ou quando passado certo tempo de exposição. Quando o ciclo de mudança do estado ativo para o inativo é um pouco lento, ele é geralmente compatível com regulações na expressão gênica, enquanto graus rápidos de mudança são relacionados com uma regulação comportamental (que não envolve diretamente uma regulação gênica, como por exemplo o aumento da taxa de motilidade de uma bactéria quando exposta à luz). Um ciclo de mudança ainda mais rápido sugere funções bioenergéticas para o fotoreceptor. Isso é um parâmetro importante a se levar em conta no design de dispositivos sintéticos fotossensíveis.

No fundo, talvez grande parte da própria biologia  sintética se resume ao que discutimos aqui: mudança de informação com recombinação. Caímos então no ponto recursivo da biologia. À diferentes níveis e abordagens sempre teremos  a mesma simples metáfora dos blocos de montar: os blocos sempre são os mesmos, o que muda é a informação que colocamos neles ao fazermos diferentes estruturas com diferentes combinações das unidades. Quer um light switch específico que ainda não foi feito? Já está pronto, só basta combinar informação.

Em posts futuros mostraremos como combinar inputs e outputs para criar light switches de outras cores, novamente, com as construções feitas pelos de times de edições passadas do iGEM. Para maiores e melhores informações sobre fotorreceptores, vale consultar o ótimo review de Michael van der Hornst et al:

van der Horst MA, Key J, & Hellingwerf KJ (2007). Photosensing in chemotrophic, non-phototrophic bacteria: let there be light sensing too. Trends in microbiology, 15 (12), 554-62 PMID: 18024131

Portas Lógicas em Sistemas Gênicos

ResearchBlogging.org

A associação da biologia sintética com a eletrônica é bem grande. A semelhança entre a interação de enzimas, fatores de transcrição e DNA, e circuitos elétricos gera uma interessante conexão interdisciplinar entre engenharia elétrica e biologia, tanto que os próprios fundadores do iGEM e do registry of parts são engenheiros elétricos!

Algumas boas analogias, ou melhor, interpretações dos sistemas gênicos, são feitas com o uso de portas lógicas para classificar o comportamento das interações gênicas. Portas lógicas baseiam-se na lógica booleana, usada largamente em computação. Para entender melhor, vamos ver uns dois exemplos: o NOR e AND.

NOR (“not OR”, o inverso do resultado para a porta OR, conhecido também como NEM):

Imagem retirada e modificada da referência (Khalil, A., & Collins, J.).
 

Como já foi mostrado aqui no blog, esse dispositivo possui dois estados estáveis que podem ser ligados ou desligados através de inputs específicos. Retirando esse input, no caso sinais exógenos como calor e IPTG, o sistema preserva o seu estado, criando assim uma forma molecular não exclusivamente estrutural (i.e. conformação de proteínas e etc) de memória na célula. O raciocínio é o mesmo em eletrônica, como no circuito flip-flop do tipo set-reset, que é capaz de servir como uma memória de um bit em circuitos digitais.

O sistema pode ser interpretado através da tabela verdade de NOR: As entradas são as interações (de repressão ou ativação) do sinal exógeno e do produto gênico, enquanto os números 0 e 1 associados à falso e verdadeiro, podem ser interpretados respectivamente como repressão e ativação nas colunas da entrada, e existência (um) ou não (zero) de
um output na coluna da saída. Então por exemplo, tendo A como o calor (heat) e B como a proteína repressora Cl (produzida por cl-ts) só se terá uma saída (o número 1), ou melhor, um estado estável do toggle (em que é expresso apenas um conjunto de genes), se houver uma interação entre repressões, ou seja, a repressão do repressor, no caso o calor reprimindo a repressão de Cl de lacl, que produz um estado estável de produção de Ptrc2 e GFP (green flourescent protein). Para o outro estado estável, com produção de Cl e repressão do gene lacl, a idéia é a mesma, basta fazer A igual à IPTG e B igual à Ptrc2.

AND (conhecido também por E):

Imagem retirada e modificada da referência (Khalil, A., & Collins, J.).
 

Nesse exemplo, são necessários dois inputs para se obter o output: um de arabinose para transcrever a polimerase T7 com dois stop codons âmbar (é uma classe de stop codons, representada no desenho como pequeninos círculos vermelhos com pontas) no código do seu gene (a polimerase é necessária para expressar o sinal de GFP); e outro sinal de salicilato que promove a transcrição de supD, um RNA transportador supressor de stop codons âmbar. Desse modo, tomando A da tabela verdade como a arabinose, e B como salicilato, pode-se ver claramente que apenas com a ativação da transcrição feita por esses fatores a expressão desses dois genes, pode ocorrer o output de luz fluorescente verde dada pela GFP: o produto de supD suprime os stop codons do gene t7pol, permitindo a transcrição completa de polimerase T7.

Esse é um exemplo de quão sofisticado um sistema gênico pode ser ao se ligar a informação sensorial de múltiplos elementos sensitivos a uma expressão gênica programada. O interessante dessa interface entre engenharia elétrica e microbiologia é a possibilidade de construção de sistemas gênicos com o mesmo princípio de uma série de outros dispositivos já existentes na engenharia, e também o contrário: (porque não!?) usar os dispositivos moleculares que a própria natureza criou e aplicá-los na eletrônica.

Para mais informações sobre outros sistemas bem interessantes, vale ver o review muito legal sobre biologia sintética:

Khalil, A., & Collins, J. (2010). Synthetic biology: applications come of age Nature Reviews Genetics, 11 (5), 367-379 DOI: 10.1038/nrg2775

Biologia sintética e a computação

ResearchBlogging.org

Ontem tivemos nossa primeira reunião do Clube Científico de Biologia Sintética para discutir o artigo “Synthetic biology: new engineering rules for an emerging disciplines.”  A imagem abaixo resume bastante a abordagem dos autores do Departamento de Engenharia Elétrica Princeton para conduzir a revisão sobre o assunto.

Os autores traçam um paralelo entre a biologia e os computadores, no qual, não apenas se procura explicar a biologia celular utilizando a computação como analogia, mas também, mostra que já foram desenvolvidos componentes biológicos que funcionam como componentes de computadores. São dados exemplos de várias construções biológicas sintéticas que funcionam como componentes elétricos, como inversores (inverters devices), flip-flops (toggle-swicthes), osciladores (oscilators), amplificadores de sinais (transcriptonal cascades modules) e desviadores de sinais (diverter scaffolds). Restando assim, poucos módulos para se construir um microcomputador celular sintético.

Os autores comentam como estes módulos sintéticos e a condição endógena celular influenciam o comportamento um do outro,  sendo que qualquer flutuação nos processos da célula hospedeira podem influenciar o módulo e sua reposta (output). Dessa maneira, torna-se necessário combinar técnicas de estimação de parâmetros e técnicas de análises de fluxos metabólicos para entender o contexto celular e os impactos desses módulos na célula. Para explicar isto de uma maneira resumida, a conectividade dos módulos entre si e com a célula não é suficiente para definir a dinâmica de uma rede, é preciso também incluir parâmetros cinéticos e regulatórios (velocidade das reações, feedbacks, efeito de reguladores…) que podem variar sua atividade de acordo com as mudanças realizadas no sistema original. Estes cálculos, porém, são muitos complicados e demandam uma matématica muito avançada. O que demonstra, mais uma vez, a necessidade de equipes multidisciplinares para a formação de grupos de pesquisa em synbio.

O artigo mostra também que células sintéticas estão se tornando cada vez mais fáceis de construir. Não só pela nossa capacidade de manipular os componentes celular, mas pelo aumento da nossa capacidade de sintetizar DNA. Existem porém, desafios e limitações nos tipos de atividades complexas que uma célula independente consegue realizar de uma forma confiável. Assim, uma nova fronteira para a synbio é distribuir redes e módulos sintéticos entre múltiplas células, formando sistemas de comunicações célula-célula, visando aumentar a possibilidade de desenhos e superar a confiança limitada de células sintéticas individuais. Para isso, já estão se desenvolvendo módulos de quorum sensing (mecanismos de comunicação celular) sintéticos que possibilitam a coordenação do comportamento de comunidades microbianas. Verifica-se, portanto, que muitos avanços têm sido realizados para aumentar a complexidade da arquitetura das redes sintéticas.

Este artigo é particularmente interessante porque mostra a visão de engenheiros elétricos do que é a biologia sintética. É importante destacar que existem diferentes visões e abordagens de pesquisa a respeito do que é a biologia sintética e como ela pode ser aplicada, dependendo da especialidade e background do grupo de pesquisa.

Nas próximas reuniões pretendemos abordar tópicos mais específicos da biologia sintética, como a construção de um oscilador sintético, e mostrar diferentes visões da biologia sintética.

Até lá!

Andrianantoandro, E., Basu, S., Karig, D., & Weiss, R. (2006). Synthetic biology: new engineering rules for an emerging discipline Molecular Systems Biology, 2 DOI: 10.1038/msb4100073

Podcast: Futures in Biotech

Preciso divulgar esta dica dada pelo meu estimado colega Atila: o podcast realizado pelo site Futures in Biotech. Já escutei os seis primeiros e são sensacionais. Os dois entrevistadores, Marc Pelletier (Pos-doc em Yale) e Leo Laporte, um especialista em TI interessado em Biotech, conseguem extrair dos entrevistados o conteúdo de suas pesquisas de uma forma simples e ao mesmo tempo profunda. Estou mandando o link das entrevistas mais antigas, acho que vale a pena escutar os episódios dos mais antigos para os mais recentes, para acompanhar os podcasts de uma maneira mais didática.

Aulas de Introdução à Biologia Sintética do MIT

O MIT é pioneiro no campo da Biologia Sintética, foi a primeira universidade a criar o curso de Biological Engineering ou Bioengenharia, especializado em Synbio. Uma ótima notícia é que esta incrível universidade, através do MIT Opencourseware, disponibiliza gratuitamente cursos, palestras e aulas para qualquer um. Segue o link para quatro aulas de Introdução a Bioengenharia que podem ser vistas no YouTube. Esse curso infelizmente não está completo, mas muitos outros estão completos, como o Introduction for Computer Science and Programming.

Andrew Hessel introduz Biologia Sintética

Andrew Hessel, pesquisador do iGEM, introduz a Biologia Sintética na Conferência de Biotecnologia e Bioinformática de 2009 fazendo um interessante paralelo entre computação e biologia.

“Células são processadores de informações e o DNA é a linguagem de programação.”

 [youtube=http://www.youtube.com/watch?v=niQ0kkgPxJk&feature=player_embedded]

Skip to content

Sobre ScienceBlogs Brasil | Anuncie com ScienceBlogs Brasil | Política de Privacidade | Termos e Condições | Contato


ScienceBlogs por Seed Media Group. Group. ©2006-2011 Seed Media Group LLC. Todos direitos garantidos.


Páginas da Seed Media Group Seed Media Group | ScienceBlogs | SEEDMAGAZINE.COM